\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517787481:

Variant ID: vg0517787481 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17787481
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GACTCAACAGTAGTCTGTCCATCCATCCAACCATTCATTCATTCATGCACCACAGCAGCTGATAGTGTAATTGACTATAATTTGACTAATTTAATCCATA[A/T]
AATCTGGGAACGAGTACGACAATGCATCCAATGAATACCTCTGAAATAGGAGAACCATCATTTCCCTATGGTGTTCCTAAACAAAATGCACCCTTTAACA

Reverse complement sequence

TGTTAAAGGGTGCATTTTGTTTAGGAACACCATAGGGAAATGATGGTTCTCCTATTTCAGAGGTATTCATTGGATGCATTGTCGTACTCGTTCCCAGATT[T/A]
TATGGATTAAATTAGTCAAATTATAGTCAATTACACTATCAGCTGCTGTGGTGCATGAATGAATGAATGGTTGGATGGATGGACAGACTACTGTTGAGTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 3.20% 1.57% 47.10% NA
All Indica  2759 19.20% 5.30% 2.50% 73.00% NA
All Japonica  1512 90.90% 0.00% 0.20% 8.86% NA
Aus  269 78.80% 1.50% 0.74% 18.96% NA
Indica I  595 24.90% 9.10% 2.52% 63.53% NA
Indica II  465 36.30% 0.40% 2.37% 60.86% NA
Indica III  913 4.80% 5.10% 3.07% 86.97% NA
Indica Intermediate  786 21.40% 5.60% 1.91% 71.12% NA
Temperate Japonica  767 96.10% 0.00% 0.00% 3.91% NA
Tropical Japonica  504 79.80% 0.00% 0.60% 19.64% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 2.20% 0.00% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517787481 A -> T LOC_Os05g30710.1 upstream_gene_variant ; 1507.0bp to feature; MODIFIER silent_mutation Average:11.935; most accessible tissue: Callus, score: 77.392 N N N N
vg0517787481 A -> T LOC_Os05g30720.1 upstream_gene_variant ; 717.0bp to feature; MODIFIER silent_mutation Average:11.935; most accessible tissue: Callus, score: 77.392 N N N N
vg0517787481 A -> T LOC_Os05g30710-LOC_Os05g30720 intergenic_region ; MODIFIER silent_mutation Average:11.935; most accessible tissue: Callus, score: 77.392 N N N N
vg0517787481 A -> DEL N N silent_mutation Average:11.935; most accessible tissue: Callus, score: 77.392 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517787481 NA 8.33E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 7.93E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 2.39E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 2.49E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 8.83E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 3.33E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 2.57E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 3.55E-06 1.71E-06 mr1145 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 9.32E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 4.66E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 1.17E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 1.17E-10 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 5.62E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 4.07E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 5.03E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 1.36E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 2.63E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 9.72E-06 mr1783 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 5.33E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 7.64E-11 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517787481 NA 2.04E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251