\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517753178:

Variant ID: vg0517753178 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17753178
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGGTCAACGAGCTATTTGAAGGATGAATAAGGATTGTTCCAGTTTTAGACTGACATGGCCATGCGTATGGAGTGTAAACTTTAAATCAGTTACGACGA[T/G]
AAGAGAGGGCGAGGCTAAGGTTAAATAAGTTCAACTGTATTTTGATATGTTCCCACCTCATTCTACTTTTTTCCTAGGAAATCCTCATTCTACCTTACTA

Reverse complement sequence

TAGTAAGGTAGAATGAGGATTTCCTAGGAAAAAAGTAGAATGAGGTGGGAACATATCAAAATACAGTTGAACTTATTTAACCTTAGCCTCGCCCTCTCTT[A/C]
TCGTCGTAACTGATTTAAAGTTTACACTCCATACGCATGGCCATGTCAGTCTAAAACTGGAACAATCCTTATTCATCCTTCAAATAGCTCGTTGACCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.30% 0.10% 5.56% 0.00% NA
All Indica  2759 91.10% 0.10% 8.77% 0.00% NA
All Japonica  1512 98.90% 0.00% 1.06% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 80.30% 0.50% 19.16% 0.00% NA
Indica II  465 92.90% 0.00% 7.10% 0.00% NA
Indica III  913 99.50% 0.00% 0.55% 0.00% NA
Indica Intermediate  786 88.40% 0.10% 11.45% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 97.40% 0.00% 2.58% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517753178 T -> G LOC_Os05g30640.1 3_prime_UTR_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:83.041; most accessible tissue: Zhenshan97 root, score: 90.835 N N N N
vg0517753178 T -> G LOC_Os05g30650.1 upstream_gene_variant ; 2372.0bp to feature; MODIFIER silent_mutation Average:83.041; most accessible tissue: Zhenshan97 root, score: 90.835 N N N N
vg0517753178 T -> G LOC_Os05g30660.1 downstream_gene_variant ; 3781.0bp to feature; MODIFIER silent_mutation Average:83.041; most accessible tissue: Zhenshan97 root, score: 90.835 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0517753178 T G 0.05 0.03 0.02 0.03 0.05 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517753178 NA 1.46E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 1.82E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 3.18E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 1.07E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 7.32E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 3.79E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 3.75E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 9.77E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 4.32E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 2.44E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 8.57E-08 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 5.76E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 2.44E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 1.28E-13 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 1.02E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 1.05E-06 NA mr1671 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 4.09E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 1.91E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 2.07E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517753178 NA 8.60E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251