\
| Variant ID: vg0517737761 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17737761 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGATCCGTCGTTGACTAAGATCGACCCCGATCACCTGCACACACATGAATCAAACAACCGTTGTCTTGGCACAGATGTCGCAACCTGACCAATGTTAGT[C/A]
TACGCACACACTTCTTGCACTTCCGGTACTTGTCAATTTCCCATCACAAAAGAACTATAACCACACATGGTTTCACATCACTAGAGTCTTGAATAGGGAT
ATCCCTATTCAAGACTCTAGTGATGTGAAACCATGTGTGGTTATAGTTCTTTTGTGATGGGAAATTGACAAGTACCGGAAGTGCAAGAAGTGTGTGCGTA[G/T]
ACTAACATTGGTCAGGTTGCGACATCTGTGCCAAGACAACGGTTGTTTGATTCATGTGTGTGCAGGTGATCGGGGTCGATCTTAGTCAACGACGGATCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 2.40% | 2.14% | 41.39% | NA |
| All Indica | 2759 | 39.80% | 0.10% | 3.12% | 57.01% | NA |
| All Japonica | 1512 | 84.60% | 7.30% | 0.66% | 7.47% | NA |
| Aus | 269 | 9.70% | 0.00% | 0.74% | 89.59% | NA |
| Indica I | 595 | 47.60% | 0.20% | 3.03% | 49.24% | NA |
| Indica II | 465 | 54.20% | 0.00% | 2.37% | 43.44% | NA |
| Indica III | 913 | 31.80% | 0.10% | 3.83% | 64.29% | NA |
| Indica Intermediate | 786 | 34.60% | 0.10% | 2.80% | 62.47% | NA |
| Temperate Japonica | 767 | 97.30% | 0.10% | 0.13% | 2.48% | NA |
| Tropical Japonica | 504 | 59.50% | 21.00% | 1.59% | 17.86% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.20% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 67.80% | 2.20% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517737761 | C -> DEL | N | N | silent_mutation | Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0517737761 | C -> A | LOC_Os05g30610.1 | upstream_gene_variant ; 1636.0bp to feature; MODIFIER | silent_mutation | Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0517737761 | C -> A | LOC_Os05g30620.1 | upstream_gene_variant ; 263.0bp to feature; MODIFIER | silent_mutation | Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0517737761 | C -> A | LOC_Os05g30630.1 | downstream_gene_variant ; 4577.0bp to feature; MODIFIER | silent_mutation | Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg0517737761 | C -> A | LOC_Os05g30610-LOC_Os05g30620 | intergenic_region ; MODIFIER | silent_mutation | Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517737761 | NA | 1.83E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 2.73E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 4.68E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 1.57E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | 2.09E-06 | 7.04E-08 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 5.93E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | 4.47E-07 | 4.47E-07 | mr1436 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 6.20E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 2.42E-10 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 1.18E-10 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 2.62E-06 | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 1.14E-07 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 2.35E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | 2.28E-06 | 2.28E-06 | mr1145_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 1.40E-08 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517737761 | NA | 9.32E-08 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |