\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517737761:

Variant ID: vg0517737761 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17737761
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGATCCGTCGTTGACTAAGATCGACCCCGATCACCTGCACACACATGAATCAAACAACCGTTGTCTTGGCACAGATGTCGCAACCTGACCAATGTTAGT[C/A]
TACGCACACACTTCTTGCACTTCCGGTACTTGTCAATTTCCCATCACAAAAGAACTATAACCACACATGGTTTCACATCACTAGAGTCTTGAATAGGGAT

Reverse complement sequence

ATCCCTATTCAAGACTCTAGTGATGTGAAACCATGTGTGGTTATAGTTCTTTTGTGATGGGAAATTGACAAGTACCGGAAGTGCAAGAAGTGTGTGCGTA[G/T]
ACTAACATTGGTCAGGTTGCGACATCTGTGCCAAGACAACGGTTGTTTGATTCATGTGTGTGCAGGTGATCGGGGTCGATCTTAGTCAACGACGGATCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 2.40% 2.14% 41.39% NA
All Indica  2759 39.80% 0.10% 3.12% 57.01% NA
All Japonica  1512 84.60% 7.30% 0.66% 7.47% NA
Aus  269 9.70% 0.00% 0.74% 89.59% NA
Indica I  595 47.60% 0.20% 3.03% 49.24% NA
Indica II  465 54.20% 0.00% 2.37% 43.44% NA
Indica III  913 31.80% 0.10% 3.83% 64.29% NA
Indica Intermediate  786 34.60% 0.10% 2.80% 62.47% NA
Temperate Japonica  767 97.30% 0.10% 0.13% 2.48% NA
Tropical Japonica  504 59.50% 21.00% 1.59% 17.86% NA
Japonica Intermediate  241 96.70% 1.20% 0.41% 1.66% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 67.80% 2.20% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517737761 C -> DEL N N silent_mutation Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0517737761 C -> A LOC_Os05g30610.1 upstream_gene_variant ; 1636.0bp to feature; MODIFIER silent_mutation Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0517737761 C -> A LOC_Os05g30620.1 upstream_gene_variant ; 263.0bp to feature; MODIFIER silent_mutation Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0517737761 C -> A LOC_Os05g30630.1 downstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 N N N N
vg0517737761 C -> A LOC_Os05g30610-LOC_Os05g30620 intergenic_region ; MODIFIER silent_mutation Average:48.008; most accessible tissue: Minghui63 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517737761 NA 1.83E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 2.73E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 4.68E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 1.57E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 2.09E-06 7.04E-08 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 5.93E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 4.47E-07 4.47E-07 mr1436 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 6.20E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 2.42E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 1.18E-10 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 2.62E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 1.14E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 2.35E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 2.28E-06 2.28E-06 mr1145_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 1.40E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517737761 NA 9.32E-08 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251