\
| Variant ID: vg0517733343 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17733343 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 96. )
TCGAGAAATGTCAAAAATAGGAGATTCAGAAGCATCAAGAACTCGAGACCTGTCCTTTTCGAAACGAACTTCCAGATTTTCATCACAGAGTTGTGAAACA[G/A]
AGAGCGAATTGTACTTAAGCTTACTTACAAGCGCGACATCCTTCAGCATGAATTTGTCATTGACCTTGATTGTTCCTTTAGCCATCACGCGTCCACTGCT
AGCAGTGGACGCGTGATGGCTAAAGGAACAATCAAGGTCAATGACAAATTCATGCTGAAGGATGTCGCGCTTGTAAGTAAGCTTAAGTACAATTCGCTCT[C/T]
TGTTTCACAACTCTGTGATGAAAATCTGGAAGTTCGTTTCGAAAAGGACAGGTCTCGAGTTCTTGATGCTTCTGAATCTCCTATTTTTGACATTTCTCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.50% | 19.70% | 16.76% | 43.00% | NA |
| All Indica | 2759 | 7.50% | 5.90% | 20.44% | 66.07% | NA |
| All Japonica | 1512 | 42.10% | 49.00% | 1.06% | 7.87% | NA |
| Aus | 269 | 7.80% | 0.00% | 70.26% | 21.93% | NA |
| Indica I | 595 | 10.60% | 1.00% | 32.61% | 55.80% | NA |
| Indica II | 465 | 6.20% | 25.60% | 16.34% | 51.83% | NA |
| Indica III | 913 | 5.30% | 0.50% | 12.71% | 81.49% | NA |
| Indica Intermediate | 786 | 8.70% | 4.30% | 22.65% | 64.38% | NA |
| Temperate Japonica | 767 | 71.70% | 25.30% | 0.65% | 2.35% | NA |
| Tropical Japonica | 504 | 6.20% | 73.00% | 1.39% | 19.44% | NA |
| Japonica Intermediate | 241 | 22.80% | 74.30% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 21.10% | 31.10% | 13.33% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517733343 | G -> DEL | LOC_Os05g30610.1 | N | frameshift_variant | Average:11.379; most accessible tissue: Minghui63 young leaf, score: 15.967 | N | N | N | N |
| vg0517733343 | G -> A | LOC_Os05g30610.1 | missense_variant ; p.Ser714Phe; MODERATE | nonsynonymous_codon ; S714F | Average:11.379; most accessible tissue: Minghui63 young leaf, score: 15.967 | probably damaging |
2.23 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517733343 | NA | 1.98E-11 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0517733343 | 4.36E-06 | 2.02E-12 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | 2.97E-06 | 1.75E-08 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | NA | 6.94E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | 3.18E-06 | 3.18E-06 | mr1181_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | 2.02E-06 | 2.01E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | NA | 3.00E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | NA | 3.93E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517733343 | NA | 4.50E-07 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |