\
| Variant ID: vg0517732975 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 17732975 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 80. )
TAGCGAGAGAAATCATCCACAACAACCAAGACATACCACTTCCCCCCAATTGACTGGACCCGAGCAGGACCAACCGTATCCATGTGAAGCAGTTATCCCG[G/A]
TCCATCTGTCATAACCATTGTAACAGGCTTGTGGGAGGAAGATGTCATTTTTCCATGACGACATGGTGCACACATAAGACCTTTCGGAGCTTTCAACTTA
TAAGTTGAAAGCTCCGAAAGGTCTTATGTGTGCACCATGTCGTCATGGAAAAATGACATCTTCCTCCCACAAGCCTGTTACAATGGTTATGACAGATGGA[C/T]
CGGGATAACTGCTTCACATGGATACGGTTGGTCCTGCTCGGGTCCAGTCAATTGGGGGGAAGTGGTATGTCTTGGTTGTTGTGGATGATTTCTCTCGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 19.40% | 0.91% | 0.97% | NA |
| All Indica | 2759 | 93.70% | 5.50% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 47.00% | 48.90% | 1.12% | 3.04% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.30% | 1.51% | 0.00% | NA |
| Indica II | 465 | 74.60% | 24.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 3.80% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 73.00% | 25.20% | 0.52% | 1.30% | NA |
| Tropical Japonica | 504 | 17.50% | 73.00% | 2.58% | 6.94% | NA |
| Japonica Intermediate | 241 | 25.70% | 73.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 27.80% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0517732975 | G -> DEL | LOC_Os05g30610.1 | N | frameshift_variant | Average:10.009; most accessible tissue: Callus, score: 20.55 | N | N | N | N |
| vg0517732975 | G -> A | LOC_Os05g30610.1 | missense_variant ; p.Thr814Ile; MODERATE | nonsynonymous_codon ; T814I | Average:10.009; most accessible tissue: Callus, score: 20.55 | unknown | unknown | DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0517732975 | NA | 5.46E-12 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0517732975 | NA | 3.13E-06 | mr1002 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 7.53E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 2.49E-06 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 4.41E-07 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 3.47E-08 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 6.24E-10 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 3.15E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | 4.86E-07 | 4.86E-07 | mr1181_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | 5.20E-06 | 5.17E-06 | mr1197_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 6.12E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 7.80E-06 | mr1399_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0517732975 | NA | 9.28E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |