Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0517538140:

Variant ID: vg0517538140 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 17538140
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAGAATGTATAAAATCTTCTCAAATGCTATTGTCGTCAGCTACTCACATCAGCTGCCAGTTGTGCCATATAACGCATTCAATCCGCCTCCACAGGTAC[G/A]
TATCCGAAATCTTCAACCCATGACCAAAACATAATCTTGTCTTCATGTTGAGTTAACTACCGTGGAGGCATCTCATTCAGGAATATGTATTGATGAAGTC

Reverse complement sequence

GACTTCATCAATACATATTCCTGAATGAGATGCCTCCACGGTAGTTAACTCAACATGAAGACAAGATTATGTTTTGGTCATGGGTTGAAGATTTCGGATA[C/T]
GTACCTGTGGAGGCGGATTGAATGCGTTATATGGCACAACTGGCAGCTGATGTGAGTAGCTGACGACAATAGCATTTGAGAAGATTTTATACATTCTCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	8.70%	5.61%	23.47%	NA
All Indica	2759	53.40%	5.00%	6.71%	34.87%	NA
All Japonica	1512	75.80%	17.20%	3.51%	3.51%	NA
Aus	269	65.40%	0.00%	7.81%	26.77%	NA
Indica I	595	50.60%	0.00%	7.39%	42.02%	NA
Indica II	465	39.10%	24.10%	6.88%	29.89%	NA
Indica III	913	63.60%	0.00%	5.81%	30.56%	NA
Indica Intermediate	786	52.20%	3.30%	7.12%	37.40%	NA
Temperate Japonica	767	94.40%	2.50%	1.17%	1.96%	NA
Tropical Japonica	504	44.60%	42.10%	6.15%	7.14%	NA
Japonica Intermediate	241	81.70%	12.00%	5.39%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	57.80%	13.30%	5.56%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0517538140	G -> DEL	N	N	silent_mutation	Average:11.406; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0517538140	G -> A	LOC_Os05g30260.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:11.406; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0517538140	G -> A	LOC_Os05g30250.1	downstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:11.406; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0517538140	G -> A	LOC_Os05g30270.1	downstream_gene_variant ; 2351.0bp to feature; MODIFIER	silent_mutation	Average:11.406; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0517538140	G -> A	LOC_Os05g30250.2	downstream_gene_variant ; 3494.0bp to feature; MODIFIER	silent_mutation	Average:11.406; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0517538140	NA	1.46E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	3.07E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	2.69E-06	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	6.69E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	3.27E-07	mr1415	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	6.89E-06	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	9.69E-08	9.68E-08	mr1562	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	3.27E-07	mr1567	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	3.77E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517538140	NA	2.19E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251