\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0517221319:

Variant ID: vg0517221319 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 17221319
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTCCCAACCCGGAAATGCTAATGGGTGATTGATCGCCTGGCGATGGGGGTAGCGATCAATTCGCCCCCCCTCCCTATCCCTCCACCTGGTTTCCTTT[T/C]
TTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAGTTTATACACCTCAATTTTACACATCTAAAGTTTAGAGACCCAAAGTTTATA

Reverse complement sequence

TATAAACTTTGGGTCTCTAAACTTTAGATGTGTAAAATTGAGGTGTATAAACTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAA[A/G]
AAAGGAAACCAGGTGGAGGGATAGGGAGGGGGGGCGAATTGATCGCTACCCCCATCGCCAGGCGATCAATCACCCATTAGCATTTCCGGGTTGGGAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 49.00% 0.28% 0.00% NA
All Indica  2759 78.40% 21.20% 0.36% 0.00% NA
All Japonica  1512 9.40% 90.60% 0.00% 0.00% NA
Aus  269 19.30% 80.30% 0.37% 0.00% NA
Indica I  595 71.80% 27.70% 0.50% 0.00% NA
Indica II  465 74.00% 25.80% 0.22% 0.00% NA
Indica III  913 82.40% 17.50% 0.11% 0.00% NA
Indica Intermediate  786 81.40% 17.90% 0.64% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 21.20% 78.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 43.30% 54.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0517221319 T -> C LOC_Os05g29770.1 upstream_gene_variant ; 1117.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29760.1 downstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29760.3 downstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29760.4 downstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29760.2 downstream_gene_variant ; 4543.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29760.5 downstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N
vg0517221319 T -> C LOC_Os05g29770-LOC_Os05g29780 intergenic_region ; MODIFIER silent_mutation Average:38.518; most accessible tissue: Callus, score: 47.927 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0517221319 NA 8.12E-06 mr1580 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319 NA 1.69E-11 mr1446_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319 NA 6.22E-06 mr1446_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319 NA 1.53E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0517221319 NA 1.93E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251