\
| Variant ID: vg0516403916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16403916 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 68. )
TTATGAATGGAGATTCACAAATAGACTTCAATAATGTGTTCTCCTTATCTTTTATTGGTTATTTTTATCTTTATGCGCTGGTTGCTATTATTTTTGGACT[G/A]
CACTTGTTTTGAGTGCAAGATTGTAATATTGGATTGTAGCGCTTTTGAGCAAAGGCCGGGATGTTATATTCCAACGCGCCAAAAAATCAATCTCGCGTGT
ACACGCGAGATTGATTTTTTGGCGCGTTGGAATATAACATCCCGGCCTTTGCTCAAAAGCGCTACAATCCAATATTACAATCTTGCACTCAAAACAAGTG[C/T]
AGTCCAAAAATAATAGCAACCAGCGCATAAAGATAAAAATAACCAATAAAAGATAAGGAGAACACATTATTGAAGTCTATTTGTGAATCTCCATTCATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.10% | 6.30% | 17.41% | 51.25% | NA |
| All Indica | 2759 | 14.30% | 6.40% | 25.77% | 53.53% | NA |
| All Japonica | 1512 | 49.90% | 0.10% | 0.60% | 49.40% | NA |
| Aus | 269 | 1.10% | 39.00% | 30.48% | 29.37% | NA |
| Indica I | 595 | 11.40% | 3.00% | 11.26% | 74.29% | NA |
| Indica II | 465 | 23.20% | 3.90% | 23.87% | 49.03% | NA |
| Indica III | 913 | 7.20% | 10.60% | 39.87% | 42.28% | NA |
| Indica Intermediate | 786 | 19.30% | 5.60% | 21.50% | 53.56% | NA |
| Temperate Japonica | 767 | 85.40% | 0.00% | 0.13% | 14.47% | NA |
| Tropical Japonica | 504 | 6.30% | 0.20% | 0.99% | 92.46% | NA |
| Japonica Intermediate | 241 | 27.80% | 0.40% | 1.24% | 70.54% | NA |
| VI/Aromatic | 96 | 3.10% | 5.20% | 11.46% | 80.21% | NA |
| Intermediate | 90 | 34.40% | 7.80% | 11.11% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516403916 | G -> DEL | N | N | silent_mutation | Average:35.457; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg0516403916 | G -> A | LOC_Os05g28060-LOC_Os05g28070 | intergenic_region ; MODIFIER | silent_mutation | Average:35.457; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516403916 | NA | 2.10E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516403916 | NA | 6.75E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516403916 | NA | 7.83E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516403916 | NA | 6.85E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516403916 | 9.93E-07 | NA | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |