\
| Variant ID: vg0516367809 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16367809 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 232. )
CCATTATGAGATCGAGCTAACTCCTGTCCCAGTCTCTGTTCCAAATTCCCGTGTGGTACCACCTGCCGATTAATTCAGCTATTCCTTTTGTAATTAACTG[C/A]
TGTTACAAAGACAAAAAAACAATATGCACAAATTTGTTTAAATTTTGTACTTTTATATTAGTTTCTTTGTTTTTTTAAAAAAACTTGCTGAGACTGGTTT
AAACCAGTCTCAGCAAGTTTTTTTAAAAAAACAAAGAAACTAATATAAAAGTACAAAATTTAAACAAATTTGTGCATATTGTTTTTTTGTCTTTGTAACA[G/T]
CAGTTAATTACAAAAGGAATAGCTGAATTAATCGGCAGGTGGTACCACACGGGAATTTGGAACAGAGACTGGGACAGGAGTTAGCTCGATCTCATAATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.50% | 0.44% | 0.00% | NA |
| All Indica | 2759 | 78.00% | 21.60% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 24.30% | 75.40% | 0.33% | 0.00% | NA |
| Aus | 269 | 32.00% | 68.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.30% | 24.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 71.00% | 28.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 82.40% | 17.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 79.30% | 20.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 52.80% | 46.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.50% | 79.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 95.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 53.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516367809 | C -> A | LOC_Os05g28040.1 | upstream_gene_variant ; 3798.0bp to feature; MODIFIER | silent_mutation | Average:63.6; most accessible tissue: Callus, score: 88.698 | N | N | N | N |
| vg0516367809 | C -> A | LOC_Os05g28040-LOC_Os05g28050 | intergenic_region ; MODIFIER | silent_mutation | Average:63.6; most accessible tissue: Callus, score: 88.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516367809 | NA | 1.02E-14 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516367809 | NA | 1.69E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 9.92E-12 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | 5.01E-07 | 1.66E-07 | mr1800 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 3.79E-09 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 1.34E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 3.64E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | 6.43E-06 | 6.74E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 1.76E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 8.65E-18 | mr1540_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 2.11E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 9.53E-09 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 6.19E-18 | mr1732_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 9.16E-10 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 3.20E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 1.60E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 3.10E-08 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 9.06E-07 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 7.36E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 5.84E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516367809 | NA | 1.26E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |