\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516331935:

Variant ID: vg0516331935 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16331935
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGATAGTGAGAGAACGGGTCCAAACACAATAATGGAACATGAGAATCGAGATCAGCATGCAGTTGTGTCGATCGTTGGAAAGAAAGAAAGGAAAAAA[T/A]
TAAAAATGGACACACGCTGCCAATCGAGAAGAAACCCTAGCTAGCTTAGCTACCAAACCCTAAGCAAATTAAGCAAATTAATCGAGAGAGCGAGACGATA

Reverse complement sequence

TATCGTCTCGCTCTCTCGATTAATTTGCTTAATTTGCTTAGGGTTTGGTAGCTAAGCTAGCTAGGGTTTCTTCTCGATTGGCAGCGTGTGTCCATTTTTA[A/T]
TTTTTTCCTTTCTTTCTTTCCAACGATCGACACAACTGCATGCTGATCTCGATTCTCATGTTCCATTATTGTGTTTGGACCCGTTCTCTCACTATCTGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.50% 0.36% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 74.10% 24.90% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 92.40% 6.40% 1.17% 0.00% NA
Tropical Japonica  504 58.70% 40.90% 0.40% 0.00% NA
Japonica Intermediate  241 47.70% 50.60% 1.66% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516331935 T -> A LOC_Os05g27980.1 upstream_gene_variant ; 3500.0bp to feature; MODIFIER silent_mutation Average:74.491; most accessible tissue: Callus, score: 98.96 N N N N
vg0516331935 T -> A LOC_Os05g27990.1 upstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:74.491; most accessible tissue: Callus, score: 98.96 N N N N
vg0516331935 T -> A LOC_Os05g27980-LOC_Os05g27990 intergenic_region ; MODIFIER silent_mutation Average:74.491; most accessible tissue: Callus, score: 98.96 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0516331935 T A -0.01 0.05 0.04 0.02 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516331935 NA 3.03E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 5.94E-06 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 3.79E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 3.12E-06 2.15E-12 mr1693 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 7.21E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 3.31E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 4.79E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 1.02E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 6.53E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 8.23E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 8.08E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 8.28E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 1.11E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 2.59E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516331935 NA 2.32E-08 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251