\
| Variant ID: vg0516238439 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16238439 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.30, others allele: 0.00, population size: 213. )
CCCGTTACGATGTGTATCTACAACCTCCCCCCTGGCTATGCATGAAGAGGAAGTACATAATGATGCCGATTATTATTCAAGGCCCCAAGCAACTTGGTAA[C/T]
GACTTCGATGTGTACCTAAGACCACTGGTCGAAGATCTTAAACTGTTGTGGAAGAAGGAAGGTGTCCCCGTGTGGGACGAGGACAAACAGGAGGAGTTTA
TAAACTCCTCCTGTTTGTCCTCGTCCCACACGGGGACACCTTCCTTCTTCCACAACAGTTTAAGATCTTCGACCAGTGGTCTTAGGTACACATCGAAGTC[G/A]
TTACCAAGTTGCTTGGGGCCTTGAATAATAATCGGCATCATTATGTACTTCCTCTTCATGCATAGCCAGGGGGGAGGTTGTAGATACACATCGTAACGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 25.90% | 1.21% | 0.00% | NA |
| All Indica | 2759 | 96.60% | 1.40% | 2.03% | 0.00% | NA |
| All Japonica | 1512 | 24.70% | 75.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 1.20% | 2.18% | 0.00% | NA |
| Indica II | 465 | 96.80% | 1.70% | 1.51% | 0.00% | NA |
| Indica III | 913 | 97.40% | 1.00% | 1.64% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 1.90% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 7.00% | 93.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 53.40% | 46.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 78.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516238439 | C -> T | LOC_Os05g27850.1 | synonymous_variant ; p.Asn264Asn; LOW | synonymous_codon | Average:15.652; most accessible tissue: Zhenshan97 flag leaf, score: 21.009 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516238439 | NA | 5.87E-14 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0516238439 | 4.85E-06 | 4.85E-06 | mr1153 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 2.29E-06 | NA | mr1176 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 1.02E-06 | 1.57E-06 | mr1176 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 1.01E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 7.55E-06 | 7.55E-06 | mr1355 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 8.06E-06 | 8.06E-06 | mr1357 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 6.01E-06 | 4.95E-06 | mr1406 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 3.54E-06 | 3.54E-06 | mr1506 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 4.44E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | 6.03E-06 | NA | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 2.57E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 6.88E-37 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 1.18E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 1.15E-07 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 1.84E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516238439 | NA | 8.44E-10 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |