| Variant ID: vg0516236934 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 16236934 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATCCTCCAATGTTTTTTTTGTCATATTACATTTGGAGCTATGTTTTACACACTTTTTTGTCTCCAAAATTTAGTTGTAAGTTGATGAGAGAGAAAATTT[G/A]
TGTGGGGAAGAAAGAATATATAGAAATTTAGTTGATTCGCTAAAGAAGGTTTTATAAAATAGTTGAGAAGGAAAATATAGTGAAAGTTAATCTTAAATAA
TTATTTAAGATTAACTTTCACTATATTTTCCTTCTCAACTATTTTATAAAACCTTCTTTAGCGAATCAACTAAATTTCTATATATTCTTTCTTCCCCACA[C/T]
AAATTTTCTCTCTCATCAACTTACAACTAAATTTTGGAGACAAAAAAGTGTGTAAAACATAGCTCCAAATGTAATATGACAAAAAAAACATTGGAGGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.40% | 1.30% | 14.30% | 13.99% | NA |
| All Indica | 2759 | 61.10% | 0.60% | 18.34% | 19.97% | NA |
| All Japonica | 1512 | 85.80% | 3.00% | 5.62% | 5.49% | NA |
| Aus | 269 | 66.90% | 0.00% | 27.88% | 5.20% | NA |
| Indica I | 595 | 50.80% | 0.00% | 8.74% | 40.50% | NA |
| Indica II | 465 | 57.40% | 0.90% | 23.87% | 17.85% | NA |
| Indica III | 913 | 65.10% | 1.10% | 24.42% | 9.42% | NA |
| Indica Intermediate | 786 | 66.50% | 0.30% | 15.27% | 17.94% | NA |
| Temperate Japonica | 767 | 95.70% | 0.70% | 1.69% | 1.96% | NA |
| Tropical Japonica | 504 | 69.80% | 6.00% | 12.50% | 11.71% | NA |
| Japonica Intermediate | 241 | 88.00% | 4.60% | 3.73% | 3.73% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 1.10% | 7.78% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0516236934 | G -> DEL | N | N | silent_mutation | Average:10.669; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0516236934 | G -> A | LOC_Os05g27850.1 | upstream_gene_variant ; 574.0bp to feature; MODIFIER | silent_mutation | Average:10.669; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0516236934 | G -> A | LOC_Os05g27840-LOC_Os05g27850 | intergenic_region ; MODIFIER | silent_mutation | Average:10.669; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0516236934 | 2.72E-06 | 1.84E-15 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | NA | 7.83E-15 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | NA | 5.63E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | NA | 8.20E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | NA | 1.04E-15 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | 5.99E-08 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0516236934 | 1.39E-06 | NA | mr1798_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |