\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516207085:

Variant ID: vg0516207085 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 16207085
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTGGTGCCCTGTACGGAATGAGTAACGTACAGTAACAAGTTTTGTTTTGAGAAGTATTATTGCTAAACTAAAAACTTATAAAGGGTAAGGCCCCATT[G/C]
GACTTAGACGAAGGTGAAGATCTTTAAACGTACTTAAAAGTTAATAAAATGAGACAAGCTGTTAACACATGATTAATTAATTATTATAAACTTAAAAATA

Reverse complement sequence

TATTTTTAAGTTTATAATAATTAATTAATCATGTGTTAACAGCTTGTCTCATTTTATTAACTTTTAAGTACGTTTAAAGATCTTCACCTTCGTCTAAGTC[C/G]
AATGGGGCCTTACCCTTTATAAGTTTTTAGTTTAGCAATAATACTTCTCAAAACAAAACTTGTTACTGTACGTTACTCATTCCGTACAGGGCACCAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 4.40% 2.16% 1.97% NA
All Indica  2759 89.20% 7.40% 3.37% 0.00% NA
All Japonica  1512 93.40% 0.10% 0.40% 6.15% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 92.80% 0.00% 7.23% 0.00% NA
Indica II  465 74.40% 20.20% 5.38% 0.00% NA
Indica III  913 90.40% 9.00% 0.66% 0.00% NA
Indica Intermediate  786 93.90% 3.70% 2.42% 0.00% NA
Temperate Japonica  767 91.50% 0.10% 0.39% 7.95% NA
Tropical Japonica  504 95.40% 0.00% 0.40% 4.17% NA
Japonica Intermediate  241 95.00% 0.00% 0.41% 4.56% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0516207085 G -> DEL N N silent_mutation Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0516207085 G -> C LOC_Os05g27800.1 upstream_gene_variant ; 3890.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0516207085 G -> C LOC_Os05g27810.1 upstream_gene_variant ; 2097.0bp to feature; MODIFIER silent_mutation Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0516207085 G -> C LOC_Os05g27800-LOC_Os05g27810 intergenic_region ; MODIFIER silent_mutation Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0516207085 NA 2.33E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 2.96E-07 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 NA 5.25E-09 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 2.54E-07 NA mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 NA 1.52E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 6.44E-07 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085 NA 1.21E-11 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251