Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0516207085:

Variant ID: vg0516207085 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16207085
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTGGTGCCCTGTACGGAATGAGTAACGTACAGTAACAAGTTTTGTTTTGAGAAGTATTATTGCTAAACTAAAAACTTATAAAGGGTAAGGCCCCATT[G/C]
GACTTAGACGAAGGTGAAGATCTTTAAACGTACTTAAAAGTTAATAAAATGAGACAAGCTGTTAACACATGATTAATTAATTATTATAAACTTAAAAATA

Reverse complement sequence

TATTTTTAAGTTTATAATAATTAATTAATCATGTGTTAACAGCTTGTCTCATTTTATTAACTTTTAAGTACGTTTAAAGATCTTCACCTTCGTCTAAGTC[C/G]
AATGGGGCCTTACCCTTTATAAGTTTTTAGTTTAGCAATAATACTTCTCAAAACAAAACTTGTTACTGTACGTTACTCATTCCGTACAGGGCACCAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	4.40%	2.16%	1.97%	NA
All Indica	2759	89.20%	7.40%	3.37%	0.00%	NA
All Japonica	1512	93.40%	0.10%	0.40%	6.15%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	92.80%	0.00%	7.23%	0.00%	NA
Indica II	465	74.40%	20.20%	5.38%	0.00%	NA
Indica III	913	90.40%	9.00%	0.66%	0.00%	NA
Indica Intermediate	786	93.90%	3.70%	2.42%	0.00%	NA
Temperate Japonica	767	91.50%	0.10%	0.39%	7.95%	NA
Tropical Japonica	504	95.40%	0.00%	0.40%	4.17%	NA
Japonica Intermediate	241	95.00%	0.00%	0.41%	4.56%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	1.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516207085	G -> DEL	N	N	silent_mutation	Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0516207085	G -> C	LOC_Os05g27800.1	upstream_gene_variant ; 3890.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0516207085	G -> C	LOC_Os05g27810.1	upstream_gene_variant ; 2097.0bp to feature; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0516207085	G -> C	LOC_Os05g27800-LOC_Os05g27810	intergenic_region ; MODIFIER	silent_mutation	Average:46.266; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516207085	NA	2.33E-10	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	2.96E-07	NA	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	NA	5.25E-09	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	2.54E-07	NA	mr1039_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	NA	1.52E-10	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	6.44E-07	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516207085	NA	1.21E-11	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251