Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0516162890:

Variant ID: vg0516162890 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 16162890
Reference Allele: G	Alternative Allele: C,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGAGGGGTGGTGCACGAGCGCATCCGCAAGAACAAGTAGAAGTGAAGAGCAAGAAGGGCGCCAATTCGAGTCAGAGATGCTGATCAAGTCGAAGACTT[G/C,A]
TCCTCTCCTCTGTGTTTATTGTATAGATTTGTAGTCGTACGATTATTAGTGTAATTATTATAGATGTAAAGCTAATTATTCATTGTAGGAATAGATAATT

Reverse complement sequence

AATTATCTATTCCTACAATGAATAATTAGCTTTACATCTATAATAATTACACTAATAATCGTACGACTACAAATCTATACAATAAACACAGAGGAGAGGA[C/G,T]
AAGTCTTCGACTTGATCAGCATCTCTGACTCGAATTGGCGCCCTTCTTGCTCTTCACTTCTACTTGTTCTTGCGGATGCGCTCGTGCACCACCCCTCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	0.90%	12.99%	47.31%	NA
All Indica	2759	28.10%	1.00%	14.35%	56.51%	NA
All Japonica	1512	58.00%	0.70%	10.65%	30.62%	NA
Aus	269	31.60%	1.10%	16.36%	50.93%	NA
Indica I	595	39.00%	0.50%	17.14%	43.36%	NA
Indica II	465	32.30%	0.90%	14.84%	52.04%	NA
Indica III	913	15.30%	1.20%	12.60%	70.87%	NA
Indica Intermediate	786	32.30%	1.30%	13.99%	52.42%	NA
Temperate Japonica	767	88.30%	0.30%	3.13%	8.34%	NA
Tropical Japonica	504	19.40%	0.80%	18.65%	61.11%	NA
Japonica Intermediate	241	42.30%	2.10%	17.84%	37.76%	NA
VI/Aromatic	96	51.00%	0.00%	4.17%	44.79%	NA
Intermediate	90	50.00%	2.20%	10.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0516162890	G -> DEL	N	N	silent_mutation	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> A	LOC_Os05g27740.1	upstream_gene_variant ; 3230.0bp to feature; MODIFIER	N	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> A	LOC_Os05g27760.1	upstream_gene_variant ; 4633.0bp to feature; MODIFIER	N	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> A	LOC_Os05g27740-LOC_Os05g27760	intergenic_region ; MODIFIER	N	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> C	LOC_Os05g27740.1	upstream_gene_variant ; 3230.0bp to feature; MODIFIER	silent_mutation	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> C	LOC_Os05g27760.1	upstream_gene_variant ; 4633.0bp to feature; MODIFIER	silent_mutation	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N
vg0516162890	G -> C	LOC_Os05g27740-LOC_Os05g27760	intergenic_region ; MODIFIER	silent_mutation	Average:46.973; most accessible tissue: Zhenshan97 flower, score: 70.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0516162890	NA	2.00E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	3.03E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	6.18E-08	4.38E-09	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	2.51E-06	4.47E-07	mr1103	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	1.13E-07	1.13E-07	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	4.84E-06	1.23E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	3.27E-07	3.49E-07	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	3.84E-06	NA	mr1437	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	3.74E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	4.45E-06	NA	mr1600	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	3.53E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	5.39E-08	5.39E-08	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	5.47E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	2.60E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	5.39E-07	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	8.82E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	6.29E-07	1.45E-08	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	1.55E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	6.22E-06	1.66E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	3.71E-08	3.71E-08	mr1264_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0516162890	NA	5.77E-06	mr1949_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251