\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515523564:

Variant ID: vg0515523564 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 15523564
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTTGGGAACAGTTGATTCCAAACACAGCCCTATTCGTTTTCGAGATGGAAAAGAACTACCACATATTTGTAGTGTGTCAAGAACCGGTTTTCTTTGG[G/A]
TACATCATGCGTGAGTTCCTCTAGTTTTGTTGAAACATCAAGTTTATTATCCATTTTGTTTGCAGTAAACTATCGACTTGCTATGTTAGAATAAACTTCT

Reverse complement sequence

AGAAGTTTATTCTAACATAGCAAGTCGATAGTTTACTGCAAACAAAATGGATAATAAACTTGATGTTTCAACAAAACTAGAGGAACTCACGCATGATGTA[C/T]
CCAAAGAAAACCGGTTCTTGACACACTACAAATATGTGGTAGTTCTTTTCCATCTCGAAAACGAATAGGGCTGTGTTTGGAATCAACTGTTCCCAACATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 7.70% 0.02% 0.00% NA
All Indica  2759 87.10% 12.80% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 69.50% 30.30% 0.22% 0.00% NA
Indica III  913 85.30% 14.70% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.90% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0515523564 G -> A LOC_Os05g26760.1 upstream_gene_variant ; 3673.0bp to feature; MODIFIER silent_mutation Average:31.573; most accessible tissue: Callus, score: 40.741 N N N N
vg0515523564 G -> A LOC_Os05g26740.1 downstream_gene_variant ; 1665.0bp to feature; MODIFIER silent_mutation Average:31.573; most accessible tissue: Callus, score: 40.741 N N N N
vg0515523564 G -> A LOC_Os05g26750.1 downstream_gene_variant ; 689.0bp to feature; MODIFIER silent_mutation Average:31.573; most accessible tissue: Callus, score: 40.741 N N N N
vg0515523564 G -> A LOC_Os05g26740-LOC_Os05g26750 intergenic_region ; MODIFIER silent_mutation Average:31.573; most accessible tissue: Callus, score: 40.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0515523564 NA 5.83E-07 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.28E-06 mr1081 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.39E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 2.48E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 7.92E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 3.68E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 6.81E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 9.77E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.28E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 3.29E-06 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 4.71E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.39E-09 mr1669 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 2.72E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 6.84E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 2.16E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 7.45E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.09E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564 NA 1.06E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251