Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0515523564:

Variant ID: vg0515523564 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 15523564
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CATGTTGGGAACAGTTGATTCCAAACACAGCCCTATTCGTTTTCGAGATGGAAAAGAACTACCACATATTTGTAGTGTGTCAAGAACCGGTTTTCTTTGG[G/A]
TACATCATGCGTGAGTTCCTCTAGTTTTGTTGAAACATCAAGTTTATTATCCATTTTGTTTGCAGTAAACTATCGACTTGCTATGTTAGAATAAACTTCT

Reverse complement sequence

AGAAGTTTATTCTAACATAGCAAGTCGATAGTTTACTGCAAACAAAATGGATAATAAACTTGATGTTTCAACAAAACTAGAGGAACTCACGCATGATGTA[C/T]
CCAAAGAAAACCGGTTCTTGACACACTACAAATATGTGGTAGTTCTTTTCCATCTCGAAAACGAATAGGGCTGTGTTTGGAATCAACTGTTCCCAACATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.70%	0.02%	0.00%	NA
All Indica	2759	87.10%	12.80%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	69.50%	30.30%	0.22%	0.00%	NA
Indica III	913	85.30%	14.70%	0.00%	0.00%	NA
Indica Intermediate	786	90.10%	9.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0515523564	G -> A	LOC_Os05g26760.1	upstream_gene_variant ; 3673.0bp to feature; MODIFIER	silent_mutation	Average:31.573; most accessible tissue: Callus, score: 40.741	N	N	N	N
vg0515523564	G -> A	LOC_Os05g26740.1	downstream_gene_variant ; 1665.0bp to feature; MODIFIER	silent_mutation	Average:31.573; most accessible tissue: Callus, score: 40.741	N	N	N	N
vg0515523564	G -> A	LOC_Os05g26750.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	silent_mutation	Average:31.573; most accessible tissue: Callus, score: 40.741	N	N	N	N
vg0515523564	G -> A	LOC_Os05g26740-LOC_Os05g26750	intergenic_region ; MODIFIER	silent_mutation	Average:31.573; most accessible tissue: Callus, score: 40.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0515523564	NA	5.83E-07	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.28E-06	mr1081	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.39E-06	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	2.48E-08	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	7.92E-07	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	3.68E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	6.81E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	9.77E-06	mr1193	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.28E-06	mr1227	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	3.29E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	4.71E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.39E-09	mr1669	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	2.72E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	6.84E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	2.16E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	7.45E-06	mr1941	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.09E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0515523564	NA	1.06E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251