\
| Variant ID: vg0515214255 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 15214255 |
| Reference Allele: CATGTCAGTTACATAGTAGTTACAATTTAATTAT | Alternative Allele: C |
| Primary Allele: CATGTCAGTTACATAGTAGT TACAATTTAATTAT | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGCAGGATCGAACCCAACACCTACAACTTGGAGGTTTGTTCAACTAACCAGTTGCTCCATCATGCTTTTTTTAGCAACACTCGAGTTATATATCAGTTA[CATGTCAGTTACATAGTAGTTACAATTTAATTAT/C]
ATAGTAGTTACATTTGAAAGTTTTTCATCCAAAAACTGTCGACAGTTGTATAGCTACTCCCTACATATATATATATACACACGCAAAGGTATTAGGAAAA
TTTTCCTAATACCTTTGCGTGTGTATATATATATATGTAGGGAGTAGCTATACAACTGTCGACAGTTTTTGGATGAAAAACTTTCAAATGTAACTACTAT[ATAATTAAATTGTAACTACTATGTAACTGACATG/G]
TAACTGATATATAACTCGAGTGTTGCTAAAAAAAGCATGATGGAGCAACTGGTTAGTTGAACAAACCTCCAAGTTGTAGGTGTTGGGTTCGATCCTGCTG
| Populations | Population Size | Frequency of CATGTCAGTTACATAGTAGT TACAATTTAATTAT(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 0.10% | 0.34% | 40.92% | NA |
| All Indica | 2759 | 44.30% | 0.00% | 0.47% | 55.20% | NA |
| All Japonica | 1512 | 77.50% | 0.30% | 0.13% | 22.02% | NA |
| Aus | 269 | 80.30% | 0.00% | 0.37% | 19.33% | NA |
| Indica I | 595 | 26.10% | 0.00% | 0.50% | 73.45% | NA |
| Indica II | 465 | 63.00% | 0.00% | 0.00% | 36.99% | NA |
| Indica III | 913 | 54.40% | 0.00% | 0.44% | 45.13% | NA |
| Indica Intermediate | 786 | 35.40% | 0.00% | 0.76% | 63.87% | NA |
| Temperate Japonica | 767 | 93.50% | 0.70% | 0.13% | 5.74% | NA |
| Tropical Japonica | 504 | 52.00% | 0.00% | 0.20% | 47.82% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 0.00% | 19.92% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 0.00% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0515214255 | CATGTCAGTTACATAGTAGTTACAATTTAATTAT -> DEL | N | N | silent_mutation | Average:20.529; most accessible tissue: Callus, score: 88.602 | N | N | N | N |
| vg0515214255 | CATGTCAGTTACATAGTAGTTACAATTTAATTAT -> C | LOC_Os05g26140.1 | upstream_gene_variant ; 1826.0bp to feature; MODIFIER | silent_mutation | Average:20.529; most accessible tissue: Callus, score: 88.602 | N | N | N | N |
| vg0515214255 | CATGTCAGTTACATAGTAGTTACAATTTAATTAT -> C | LOC_Os05g26150.1 | upstream_gene_variant ; 4104.0bp to feature; MODIFIER | silent_mutation | Average:20.529; most accessible tissue: Callus, score: 88.602 | N | N | N | N |
| vg0515214255 | CATGTCAGTTACATAGTAGTTACAATTTAATTAT -> C | LOC_Os05g26140-LOC_Os05g26150 | intergenic_region ; MODIFIER | silent_mutation | Average:20.529; most accessible tissue: Callus, score: 88.602 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0515214255 | NA | 8.96E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 2.19E-06 | 5.68E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 2.31E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 8.32E-06 | 1.07E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 3.82E-08 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 2.76E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 5.59E-06 | 6.44E-09 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 5.84E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 8.19E-07 | 7.75E-10 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 3.66E-06 | 3.16E-08 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 5.89E-09 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 1.21E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 4.15E-06 | 2.81E-07 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 9.72E-06 | 1.14E-07 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 1.48E-06 | 4.38E-09 | mr1118_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 7.88E-06 | 1.16E-07 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 1.58E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 1.32E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 7.29E-07 | 5.59E-09 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 8.05E-06 | 3.02E-08 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | NA | 1.82E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0515214255 | 3.95E-08 | 2.98E-11 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |