Variant ID: vg0514963938 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 14963938 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 89. )
AGTCTTTCAGTCAATGGACTGGCGTTGGCCTTCTTGGTAGTCTCCGTATCTTGTGATAAATATCTCAGGGTAGAGTGTAATATATTTTGAATTTTTGTGG[A/G]
CTGTAAGAAATACTTGAAAATAGAGAAGGAATCTATCTAGCTAAGCTTTCTTACTCCGGATGGAGTGTGTACGAGTGTTTTCTCACTTCGCGACTTCGAT
ATCGAAGTCGCGAAGTGAGAAAACACTCGTACACACTCCATCCGGAGTAAGAAAGCTTAGCTAGATAGATTCCTTCTCTATTTTCAAGTATTTCTTACAG[T/C]
CCACAAAAATTCAAAATATATTACACTCTACCCTGAGATATTTATCACAAGATACGGAGACTACCAAGAAGGCCAACGCCAGTCCATTGACTGAAAGACT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.70% | 33.70% | 6.52% | 5.04% | NA |
All Indica | 2759 | 38.50% | 47.90% | 8.95% | 4.68% | NA |
All Japonica | 1512 | 75.50% | 14.70% | 2.78% | 7.01% | NA |
Aus | 269 | 87.40% | 10.00% | 2.60% | 0.00% | NA |
Indica I | 595 | 29.70% | 53.60% | 13.95% | 2.69% | NA |
Indica II | 465 | 49.50% | 35.30% | 7.53% | 7.74% | NA |
Indica III | 913 | 38.10% | 49.60% | 7.56% | 4.71% | NA |
Indica Intermediate | 786 | 39.10% | 49.00% | 7.63% | 4.33% | NA |
Temperate Japonica | 767 | 94.00% | 2.10% | 1.30% | 2.61% | NA |
Tropical Japonica | 504 | 49.00% | 37.10% | 3.97% | 9.92% | NA |
Japonica Intermediate | 241 | 72.20% | 7.90% | 4.98% | 14.94% | NA |
VI/Aromatic | 96 | 86.50% | 3.10% | 7.29% | 3.12% | NA |
Intermediate | 90 | 72.20% | 22.20% | 5.56% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0514963938 | A -> DEL | N | N | silent_mutation | Average:15.21; most accessible tissue: Callus, score: 37.498 | N | N | N | N |
vg0514963938 | A -> G | LOC_Os05g25720.1 | downstream_gene_variant ; 61.0bp to feature; MODIFIER | silent_mutation | Average:15.21; most accessible tissue: Callus, score: 37.498 | N | N | N | N |
vg0514963938 | A -> G | LOC_Os05g25720-LOC_Os05g25740 | intergenic_region ; MODIFIER | silent_mutation | Average:15.21; most accessible tissue: Callus, score: 37.498 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0514963938 | 1.35E-07 | 1.35E-07 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | NA | 1.67E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | 1.80E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | 5.64E-06 | 1.33E-09 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | 1.50E-06 | NA | mr1155_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | 1.75E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | NA | 7.24E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0514963938 | 1.32E-06 | 7.81E-09 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |