\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514844108:

Variant ID: vg0514844108 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14844108
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGACAAGTCTCACTTTCATACTCCCTCCGTATTTTAATATACGACGTTGTTGACTTTTTGATAAACATTTGACCTTCCATCTTATTCAAAAAATTTAT[G/A]
TAATTATAATTTATTTTATTGTGACTTGATTTATCATCAAATGTTCTTTAAGCATGACATAAGTATTTTTATATTTGCATAAAATTTTTGAATAAGACGA

Reverse complement sequence

TCGTCTTATTCAAAAATTTTATGCAAATATAAAAATACTTATGTCATGCTTAAAGAACATTTGATGATAAATCAAGTCACAATAAAATAAATTATAATTA[C/T]
ATAAATTTTTTGAATAAGATGGAAGGTCAAATGTTTATCAAAAAGTCAACAACGTCGTATATTAAAATACGGAGGGAGTATGAAAGTGAGACTTGTCTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 40.60% 1.16% 0.02% NA
All Indica  2759 84.40% 13.70% 1.81% 0.04% NA
All Japonica  1512 7.90% 92.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.60% 6.90% 6.39% 0.17% NA
Indica II  465 65.40% 33.80% 0.86% 0.00% NA
Indica III  913 91.80% 7.90% 0.33% 0.00% NA
Indica Intermediate  786 85.50% 13.90% 0.64% 0.00% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 18.30% 81.50% 0.20% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 95.80% 2.08% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514844108 G -> DEL N N silent_mutation Average:47.567; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0514844108 G -> A LOC_Os05g25540.1 downstream_gene_variant ; 61.0bp to feature; MODIFIER silent_mutation Average:47.567; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0514844108 G -> A LOC_Os05g25550.1 downstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:47.567; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0514844108 G -> A LOC_Os05g25550.2 downstream_gene_variant ; 4229.0bp to feature; MODIFIER silent_mutation Average:47.567; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg0514844108 G -> A LOC_Os05g25540-LOC_Os05g25550 intergenic_region ; MODIFIER silent_mutation Average:47.567; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514844108 8.81E-06 6.28E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 7.48E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 8.20E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 2.40E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 2.39E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 7.07E-06 mr1413 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 9.58E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 7.12E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 2.62E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 1.18E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 2.39E-06 mr1552 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 4.83E-11 mr1553 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 5.54E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 6.64E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 9.40E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 1.11E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 6.68E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 8.37E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 1.46E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 4.53E-11 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514844108 NA 1.23E-06 mr1986 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251