\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0514708030:

Variant ID: vg0514708030 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 14708030
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTCAGGAACAGCAGGTGCTAAGCTATCTTTTGCTTTCACTCTCACGTGAAATTCTTTCTCAGGTTGTTCATATGAACACTGCTGCCGGTGTCTGGACG[A/G]
CCATCGAAGGGATGTTCACGTCCCAGTCCAGAGCTCGGGCTATCAACACAAGGATGGCTCTCGCCACAACATAGAAGGATAACCTTTCTGTGATCAACTA

Reverse complement sequence

TAGTTGATCACAGAAAGGTTATCCTTCTATGTTGTGGCGAGAGCCATCCTTGTGTTGATAGCCCGAGCTCTGGACTGGGACGTGAACATCCCTTCGATGG[T/C]
CGTCCAGACACCGGCAGCAGTGTTCATATGAACAACCTGAGAAAGAATTTCACGTGAGAGTGAAAGCAAAAGATAGCTTAGCACCTGCTGTTCCTGAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 45.00% 0.19% 0.42% NA
All Indica  2759 82.50% 16.80% 0.22% 0.51% NA
All Japonica  1512 2.10% 97.80% 0.00% 0.13% NA
Aus  269 81.80% 17.80% 0.37% 0.00% NA
Indica I  595 76.60% 22.90% 0.17% 0.34% NA
Indica II  465 75.10% 24.10% 0.00% 0.86% NA
Indica III  913 89.30% 10.40% 0.22% 0.11% NA
Indica Intermediate  786 83.30% 15.40% 0.38% 0.89% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 41.10% 52.20% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0514708030 A -> DEL N N silent_mutation Average:49.339; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0514708030 A -> G LOC_Os05g25320.1 upstream_gene_variant ; 2890.0bp to feature; MODIFIER silent_mutation Average:49.339; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0514708030 A -> G LOC_Os05g25330.1 intron_variant ; MODIFIER silent_mutation Average:49.339; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0514708030 3.17E-07 7.09E-33 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 9.03E-11 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 5.27E-32 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 8.22E-11 3.51E-38 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 1.04E-06 1.90E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 4.30E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 4.20E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 1.30E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 2.02E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 4.15E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 1.20E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 1.09E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 5.22E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 2.59E-12 1.42E-46 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 1.56E-07 8.23E-10 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 NA 2.75E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 8.23E-10 3.69E-40 mr1873_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0514708030 1.06E-07 2.41E-08 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251