\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513661910:

Variant ID: vg0513661910 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 13661910
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACATGAAGCAGCCTTTAGTCCCCGTTGGTATTGTAGTTGACGAGCGGGTGCCGGTGATGGGATCACCCTGCGGCGGTGGTGATAGGAATGCCGTGCT[G/A]
CGGCGATGGTGATGAAATTCAATCTTTGGTCCCTTCAACGCGCATTAGGATCAGCAGGCTTATGGTTTTGGGAAAATCTTACCGTACATGAGTTCTCACC

Reverse complement sequence

GGTGAGAACTCATGTACGGTAAGATTTTCCCAAAACCATAAGCCTGCTGATCCTAATGCGCGTTGAAGGGACCAAAGATTGAATTTCATCACCATCGCCG[C/T]
AGCACGGCATTCCTATCACCACCGCCGCAGGGTGATCCCATCACCGGCACCCGCTCGTCAACTACAATACCAACGGGGACTAAAGGCTGCTTCATGTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 42.20% 7.64% 0.00% NA
All Indica  2759 20.00% 68.40% 11.60% 0.00% NA
All Japonica  1512 96.20% 1.70% 2.05% 0.00% NA
Aus  269 81.00% 18.60% 0.37% 0.00% NA
Indica I  595 15.10% 58.80% 26.05% 0.00% NA
Indica II  465 11.40% 76.60% 12.04% 0.00% NA
Indica III  913 26.50% 71.60% 1.86% 0.00% NA
Indica Intermediate  786 21.10% 67.20% 11.70% 0.00% NA
Temperate Japonica  767 95.60% 2.50% 1.96% 0.00% NA
Tropical Japonica  504 97.80% 0.60% 1.59% 0.00% NA
Japonica Intermediate  241 95.00% 1.70% 3.32% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 56.70% 33.30% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0513661910 G -> A LOC_Os05g23780.1 upstream_gene_variant ; 4908.0bp to feature; MODIFIER silent_mutation Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0513661910 G -> A LOC_Os05g23790.1 upstream_gene_variant ; 1451.0bp to feature; MODIFIER silent_mutation Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N
vg0513661910 G -> A LOC_Os05g23780-LOC_Os05g23790 intergenic_region ; MODIFIER silent_mutation Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0513661910 NA 5.26E-08 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 5.25E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 8.24E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 6.54E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 1.60E-06 mr1613 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 4.53E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 3.48E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 1.45E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 3.70E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910 NA 3.60E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251