Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0513661910:

Variant ID: vg0513661910 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 13661910
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GAAACATGAAGCAGCCTTTAGTCCCCGTTGGTATTGTAGTTGACGAGCGGGTGCCGGTGATGGGATCACCCTGCGGCGGTGGTGATAGGAATGCCGTGCT[G/A]
CGGCGATGGTGATGAAATTCAATCTTTGGTCCCTTCAACGCGCATTAGGATCAGCAGGCTTATGGTTTTGGGAAAATCTTACCGTACATGAGTTCTCACC

Reverse complement sequence

GGTGAGAACTCATGTACGGTAAGATTTTCCCAAAACCATAAGCCTGCTGATCCTAATGCGCGTTGAAGGGACCAAAGATTGAATTTCATCACCATCGCCG[C/T]
AGCACGGCATTCCTATCACCACCGCCGCAGGGTGATCCCATCACCGGCACCCGCTCGTCAACTACAATACCAACGGGGACTAAAGGCTGCTTCATGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	42.20%	7.64%	0.00%	NA
All Indica	2759	20.00%	68.40%	11.60%	0.00%	NA
All Japonica	1512	96.20%	1.70%	2.05%	0.00%	NA
Aus	269	81.00%	18.60%	0.37%	0.00%	NA
Indica I	595	15.10%	58.80%	26.05%	0.00%	NA
Indica II	465	11.40%	76.60%	12.04%	0.00%	NA
Indica III	913	26.50%	71.60%	1.86%	0.00%	NA
Indica Intermediate	786	21.10%	67.20%	11.70%	0.00%	NA
Temperate Japonica	767	95.60%	2.50%	1.96%	0.00%	NA
Tropical Japonica	504	97.80%	0.60%	1.59%	0.00%	NA
Japonica Intermediate	241	95.00%	1.70%	3.32%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	56.70%	33.30%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0513661910	G -> A	LOC_Os05g23780.1	upstream_gene_variant ; 4908.0bp to feature; MODIFIER	silent_mutation	Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0513661910	G -> A	LOC_Os05g23790.1	upstream_gene_variant ; 1451.0bp to feature; MODIFIER	silent_mutation	Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N
vg0513661910	G -> A	LOC_Os05g23780-LOC_Os05g23790	intergenic_region ; MODIFIER	silent_mutation	Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0513661910	NA	5.26E-08	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	5.25E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	8.24E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	6.54E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	1.60E-06	mr1613	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	4.53E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	3.48E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	1.45E-08	mr1100_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	3.70E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513661910	NA	3.60E-08	mr1613_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251