Variant ID: vg0513661910 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 13661910 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 222. )
GAAACATGAAGCAGCCTTTAGTCCCCGTTGGTATTGTAGTTGACGAGCGGGTGCCGGTGATGGGATCACCCTGCGGCGGTGGTGATAGGAATGCCGTGCT[G/A]
CGGCGATGGTGATGAAATTCAATCTTTGGTCCCTTCAACGCGCATTAGGATCAGCAGGCTTATGGTTTTGGGAAAATCTTACCGTACATGAGTTCTCACC
GGTGAGAACTCATGTACGGTAAGATTTTCCCAAAACCATAAGCCTGCTGATCCTAATGCGCGTTGAAGGGACCAAAGATTGAATTTCATCACCATCGCCG[C/T]
AGCACGGCATTCCTATCACCACCGCCGCAGGGTGATCCCATCACCGGCACCCGCTCGTCAACTACAATACCAACGGGGACTAAAGGCTGCTTCATGTTTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 50.10% | 42.20% | 7.64% | 0.00% | NA |
All Indica | 2759 | 20.00% | 68.40% | 11.60% | 0.00% | NA |
All Japonica | 1512 | 96.20% | 1.70% | 2.05% | 0.00% | NA |
Aus | 269 | 81.00% | 18.60% | 0.37% | 0.00% | NA |
Indica I | 595 | 15.10% | 58.80% | 26.05% | 0.00% | NA |
Indica II | 465 | 11.40% | 76.60% | 12.04% | 0.00% | NA |
Indica III | 913 | 26.50% | 71.60% | 1.86% | 0.00% | NA |
Indica Intermediate | 786 | 21.10% | 67.20% | 11.70% | 0.00% | NA |
Temperate Japonica | 767 | 95.60% | 2.50% | 1.96% | 0.00% | NA |
Tropical Japonica | 504 | 97.80% | 0.60% | 1.59% | 0.00% | NA |
Japonica Intermediate | 241 | 95.00% | 1.70% | 3.32% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 56.70% | 33.30% | 10.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0513661910 | G -> A | LOC_Os05g23780.1 | upstream_gene_variant ; 4908.0bp to feature; MODIFIER | silent_mutation | Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
vg0513661910 | G -> A | LOC_Os05g23790.1 | upstream_gene_variant ; 1451.0bp to feature; MODIFIER | silent_mutation | Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
vg0513661910 | G -> A | LOC_Os05g23780-LOC_Os05g23790 | intergenic_region ; MODIFIER | silent_mutation | Average:54.047; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0513661910 | NA | 5.26E-08 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 5.25E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 8.24E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 6.54E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 1.60E-06 | mr1613 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 4.53E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 3.48E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 1.45E-08 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 3.70E-08 | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0513661910 | NA | 3.60E-08 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |