Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0513518841:

Variant ID: vg0513518841 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 13518841
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGTGCTATTTGAATCCTAAACCGCTTGCAACAGTGCTCGGGGGGAGGGGGTGTTTTGTCCGGTATTAAAAGTTCAAGGTGAGCGATATCTGGTTTTCG[A/T]
GTTCAGGGGGTAATTCAGTCGACCACGATATTTCAGGGAGTAATTTGTATTTTTTTCCTAAAAAAAATGCTTCACCGACTTCTAGCTTGTAGAGAGTACC

Reverse complement sequence

GGTACTCTCTACAAGCTAGAAGTCGGTGAAGCATTTTTTTTAGGAAAAAAATACAAATTACTCCCTGAAATATCGTGGTCGACTGAATTACCCCCTGAAC[T/A]
CGAAAACCAGATATCGCTCACCTTGAACTTTTAATACCGGACAAAACACCCCCTCCCCCCGAGCACTGTTGCAAGCGGTTTAGGATTCAAATAGCACACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	3.30%	3.94%	0.00%	NA
All Indica	2759	96.20%	0.50%	3.33%	0.00%	NA
All Japonica	1512	85.10%	9.10%	5.89%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	92.10%	1.70%	6.22%	0.00%	NA
Indica II	465	96.30%	0.00%	3.66%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.80%	0.40%	4.83%	0.00%	NA
Temperate Japonica	767	77.30%	14.30%	8.34%	0.00%	NA
Tropical Japonica	504	96.80%	1.20%	1.98%	0.00%	NA
Japonica Intermediate	241	85.10%	8.70%	6.22%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	2.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0513518841	A -> T	LOC_Os05g23570.1	downstream_gene_variant ; 1031.0bp to feature; MODIFIER	silent_mutation	Average:60.748; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0513518841	A -> T	LOC_Os05g23580.1	downstream_gene_variant ; 668.0bp to feature; MODIFIER	silent_mutation	Average:60.748; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0513518841	A -> T	LOC_Os05g21220.1	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:60.748; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0513518841	A -> T	LOC_Os05g23590.1	downstream_gene_variant ; 4936.0bp to feature; MODIFIER	silent_mutation	Average:60.748; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N
vg0513518841	A -> T	LOC_Os05g23570-LOC_Os05g23580	intergenic_region ; MODIFIER	silent_mutation	Average:60.748; most accessible tissue: Minghui63 flag leaf, score: 71.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0513518841	NA	2.75E-08	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	2.28E-07	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	3.91E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	4.34E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	2.42E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	2.14E-06	2.14E-06	mr1369	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	4.03E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	8.10E-06	8.10E-06	mr1373	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	2.24E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	1.06E-06	1.05E-06	mr1445	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	3.76E-06	3.76E-06	mr1464	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	3.72E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	7.59E-07	NA	mr1648	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	4.88E-08	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	6.55E-06	5.70E-07	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	6.34E-06	9.95E-09	mr1697	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0513518841	NA	5.79E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251