Variant ID: vg0512327313 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 12327313 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )
CATAAATTAAAATGATGCTAGACTTACTTTTCCTTGCTTATTTTACTCATAATTGCTCAATAAAATTAGCTTTATGCAAATGTTGAACCTAGAGACCCAC[C/T]
ATAGGCTAGAAAGCTTGCATACTTCTTTCTCCCTTATGTATATATAATTTTGGGTAAGACTTGCGAGTACAATCTTGTACTTAACCCGGTGTCTGCAATT
AATTGCAGACACCGGGTTAAGTACAAGATTGTACTCGCAAGTCTTACCCAAAATTATATATACATAAGGGAGAAAGAAGTATGCAAGCTTTCTAGCCTAT[G/A]
GTGGGTCTCTAGGTTCAACATTTGCATAAAGCTAATTTTATTGAGCAATTATGAGTAAAATAAGCAAGGAAAAGTAAGTCTAGCATCATTTTAATTTATG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 73.10% | 19.10% | 7.72% | 0.06% | NA |
All Indica | 2759 | 84.70% | 5.30% | 9.93% | 0.11% | NA |
All Japonica | 1512 | 45.60% | 49.20% | 5.16% | 0.00% | NA |
Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
Indica I | 595 | 67.20% | 12.40% | 20.34% | 0.00% | NA |
Indica II | 465 | 82.80% | 4.90% | 12.26% | 0.00% | NA |
Indica III | 913 | 96.10% | 0.40% | 3.18% | 0.33% | NA |
Indica Intermediate | 786 | 85.80% | 5.70% | 8.52% | 0.00% | NA |
Temperate Japonica | 767 | 13.00% | 82.00% | 4.95% | 0.00% | NA |
Tropical Japonica | 504 | 86.90% | 9.10% | 3.97% | 0.00% | NA |
Japonica Intermediate | 241 | 63.10% | 28.60% | 8.30% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 1.00% | 4.17% | 0.00% | NA |
Intermediate | 90 | 76.70% | 15.60% | 7.78% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0512327313 | C -> T | LOC_Os05g20960.1 | upstream_gene_variant ; 4709.0bp to feature; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> T | LOC_Os05g20950.1 | downstream_gene_variant ; 4228.0bp to feature; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> T | LOC_Os05g20954.1 | downstream_gene_variant ; 251.0bp to feature; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> T | LOC_Os05g20954.2 | intron_variant ; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> T | LOC_Os05g20954.3 | intron_variant ; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> T | LOC_Os05g20954.4 | intron_variant ; MODIFIER | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
vg0512327313 | C -> DEL | N | N | silent_mutation | Average:51.219; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0512327313 | 2.10E-07 | NA | mr1552 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0512327313 | 3.14E-06 | 5.79E-13 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0512327313 | NA | 4.08E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0512327313 | NA | 5.97E-08 | mr1862 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |