Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0512306429:

Variant ID: vg0512306429 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 12306429
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGATAAGTGCTAGGGATTATATACTATGCACCGATTTTTAGTCCCAGTTGGTATTTCCAACCGGGAATAAAAAGAATAGGGGGCATACACTTTTTTAACC[A/G]
GGACTAAAAACGATCTTTAGTACCAACCAGACTAAAGATCATAAAATAGCTATGGGCTTTTCAACCGGGGCTAAAGATGATTTTTAGTCTGGGTTCTTTT

Reverse complement sequence

AAAAGAACCCAGACTAAAAATCATCTTTAGCCCCGGTTGAAAAGCCCATAGCTATTTTATGATCTTTAGTCTGGTTGGTACTAAAGATCGTTTTTAGTCC[T/C]
GGTTAAAAAAGTGTATGCCCCCTATTCTTTTTATTCCCGGTTGGAAATACCAACTGGGACTAAAAATCGGTGCATAGTATATAATCCCTAGCACTTATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	2.50%	8.46%	0.00%	NA
All Indica	2759	91.90%	0.80%	7.29%	0.00%	NA
All Japonica	1512	81.00%	6.30%	12.70%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	80.00%	2.40%	17.65%	0.00%	NA
Indica II	465	91.80%	0.40%	7.74%	0.00%	NA
Indica III	913	99.20%	0.00%	0.77%	0.00%	NA
Indica Intermediate	786	92.50%	0.80%	6.74%	0.00%	NA
Temperate Japonica	767	69.20%	11.60%	19.17%	0.00%	NA
Tropical Japonica	504	95.20%	0.20%	4.56%	0.00%	NA
Japonica Intermediate	241	88.40%	2.50%	9.13%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	92.20%	1.10%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0512306429	A -> G	LOC_Os05g20930.1	upstream_gene_variant ; 1629.0bp to feature; MODIFIER	silent_mutation	Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0512306429	A -> G	LOC_Os05g20920.1	downstream_gene_variant ; 3091.0bp to feature; MODIFIER	silent_mutation	Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N
vg0512306429	A -> G	LOC_Os05g20920-LOC_Os05g20930	intergenic_region ; MODIFIER	silent_mutation	Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0512306429	8.05E-09	6.47E-10	mr1588_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251