\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0512306429:

Variant ID: vg0512306429 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 12306429
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGATAAGTGCTAGGGATTATATACTATGCACCGATTTTTAGTCCCAGTTGGTATTTCCAACCGGGAATAAAAAGAATAGGGGGCATACACTTTTTTAACC[A/G]
GGACTAAAAACGATCTTTAGTACCAACCAGACTAAAGATCATAAAATAGCTATGGGCTTTTCAACCGGGGCTAAAGATGATTTTTAGTCTGGGTTCTTTT

Reverse complement sequence

AAAAGAACCCAGACTAAAAATCATCTTTAGCCCCGGTTGAAAAGCCCATAGCTATTTTATGATCTTTAGTCTGGTTGGTACTAAAGATCGTTTTTAGTCC[T/C]
GGTTAAAAAAGTGTATGCCCCCTATTCTTTTTATTCCCGGTTGGAAATACCAACTGGGACTAAAAATCGGTGCATAGTATATAATCCCTAGCACTTATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 2.50% 8.46% 0.00% NA
All Indica  2759 91.90% 0.80% 7.29% 0.00% NA
All Japonica  1512 81.00% 6.30% 12.70% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 80.00% 2.40% 17.65% 0.00% NA
Indica II  465 91.80% 0.40% 7.74% 0.00% NA
Indica III  913 99.20% 0.00% 0.77% 0.00% NA
Indica Intermediate  786 92.50% 0.80% 6.74% 0.00% NA
Temperate Japonica  767 69.20% 11.60% 19.17% 0.00% NA
Tropical Japonica  504 95.20% 0.20% 4.56% 0.00% NA
Japonica Intermediate  241 88.40% 2.50% 9.13% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 92.20% 1.10% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0512306429 A -> G LOC_Os05g20930.1 upstream_gene_variant ; 1629.0bp to feature; MODIFIER silent_mutation Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0512306429 A -> G LOC_Os05g20920.1 downstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg0512306429 A -> G LOC_Os05g20920-LOC_Os05g20930 intergenic_region ; MODIFIER silent_mutation Average:49.735; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0512306429 8.05E-09 6.47E-10 mr1588_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251