Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511846841:

Variant ID: vg0511846841 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 11846841
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTCCAACGCAGCCAAGAATCCGCGACCAACCATGCTTAGGTTCAGTGCTTCCATCTGTTGATTAAGCTCGGGTGGAATGCCTCGGACGTTGAGAGTGTT[G/A]
CCAGTGGCTCTTTCGACTTAGAGCGTCGGCAACCACGTTGGCCTTACCAGGATGATAGTGTATTCCCACATCATAATCCTTGATGAGTTCTAACCATCTC

Reverse complement sequence

GAGATGGTTAGAACTCATCAAGGATTATGATGTGGGAATACACTATCATCCTGGTAAGGCCAACGTGGTTGCCGACGCTCTAAGTCGAAAGAGCCACTGG[C/T]
AACACTCTCAACGTCCGAGGCATTCCACCCGAGCTTAATCAACAGATGGAAGCACTGAACCTAAGCATGGTTGGTCGCGGATTCTTGGCTGCGTTGGAAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.30%	25.10%	12.89%	4.70%	NA
All Indica	2759	71.50%	8.90%	16.13%	3.48%	NA
All Japonica	1512	36.40%	60.10%	3.31%	0.20%	NA
Aus	269	21.60%	0.70%	33.83%	43.87%	NA
Indica I	595	52.90%	20.30%	22.52%	4.20%	NA
Indica II	465	82.60%	6.20%	10.97%	0.22%	NA
Indica III	913	78.20%	1.00%	16.32%	4.49%	NA
Indica Intermediate	786	71.20%	10.90%	14.12%	3.69%	NA
Temperate Japonica	767	5.90%	91.70%	2.48%	0.00%	NA
Tropical Japonica	504	78.20%	17.90%	3.37%	0.60%	NA
Japonica Intermediate	241	46.50%	47.70%	5.81%	0.00%	NA
VI/Aromatic	96	78.10%	6.20%	13.54%	2.08%	NA
Intermediate	90	58.90%	26.70%	11.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0511846841	G -> DEL	LOC_Os05g20230.1	N	frameshift_variant	Average:21.336; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0511846841	G -> A	LOC_Os05g20230.1	synonymous_variant ; p.Gly1208Gly; LOW	synonymous_codon	Average:21.336; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0511846841	NA	3.99E-43	Grain_thickness	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841	NA	7.36E-14	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841	NA	7.29E-57	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841	NA	1.02E-34	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.33E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	6.71E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.70E-22	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	3.93E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	4.44E-18	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.17E-37	mr1784	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.06E-11	mr1879	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.60E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	5.61E-31	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.28E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	5.84E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	6.46E-22	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	9.68E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.45E-34	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	5.77E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.54E-27	mr1584_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.17E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.24E-26	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.96E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.97E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	1.06E-20	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.03E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.22E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	4.06E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	7.07E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	2.97E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841	NA	8.99E-16	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251