\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511846841:

Variant ID: vg0511846841 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 11846841
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCCAACGCAGCCAAGAATCCGCGACCAACCATGCTTAGGTTCAGTGCTTCCATCTGTTGATTAAGCTCGGGTGGAATGCCTCGGACGTTGAGAGTGTT[G/A]
CCAGTGGCTCTTTCGACTTAGAGCGTCGGCAACCACGTTGGCCTTACCAGGATGATAGTGTATTCCCACATCATAATCCTTGATGAGTTCTAACCATCTC

Reverse complement sequence

GAGATGGTTAGAACTCATCAAGGATTATGATGTGGGAATACACTATCATCCTGGTAAGGCCAACGTGGTTGCCGACGCTCTAAGTCGAAAGAGCCACTGG[C/T]
AACACTCTCAACGTCCGAGGCATTCCACCCGAGCTTAATCAACAGATGGAAGCACTGAACCTAAGCATGGTTGGTCGCGGATTCTTGGCTGCGTTGGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 25.10% 12.89% 4.70% NA
All Indica  2759 71.50% 8.90% 16.13% 3.48% NA
All Japonica  1512 36.40% 60.10% 3.31% 0.20% NA
Aus  269 21.60% 0.70% 33.83% 43.87% NA
Indica I  595 52.90% 20.30% 22.52% 4.20% NA
Indica II  465 82.60% 6.20% 10.97% 0.22% NA
Indica III  913 78.20% 1.00% 16.32% 4.49% NA
Indica Intermediate  786 71.20% 10.90% 14.12% 3.69% NA
Temperate Japonica  767 5.90% 91.70% 2.48% 0.00% NA
Tropical Japonica  504 78.20% 17.90% 3.37% 0.60% NA
Japonica Intermediate  241 46.50% 47.70% 5.81% 0.00% NA
VI/Aromatic  96 78.10% 6.20% 13.54% 2.08% NA
Intermediate  90 58.90% 26.70% 11.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0511846841 G -> DEL LOC_Os05g20230.1 N frameshift_variant Average:21.336; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0511846841 G -> A LOC_Os05g20230.1 synonymous_variant ; p.Gly1208Gly; LOW synonymous_codon Average:21.336; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0511846841 NA 3.99E-43 Grain_thickness All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841 NA 7.36E-14 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841 NA 7.29E-57 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511846841 NA 1.02E-34 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.33E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 6.71E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.70E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 3.93E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 4.44E-18 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.17E-37 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.06E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.60E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 5.61E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.28E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 5.84E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 6.46E-22 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 9.68E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.45E-34 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 5.77E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.54E-27 mr1584_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.17E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.24E-26 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.96E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.97E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 1.06E-20 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.03E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.22E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 4.06E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 7.07E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 2.97E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511846841 NA 8.99E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251