\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511832236:

Variant ID: vg0511832236 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 11832236
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGTAGCATCTGATACCGAGTTGAAGATTTCACTCTTTGCCTTCATAAAAACACTTTTACCTAGGTCATCTTGCTTACTTAATGACAAGGTGACTGTTG[C/T]
GGGGCAATTACAATTAGGGGTCTTCCTTGAGCGATGTAGAACATGTTTCTGTTTATTAATCACCTTTCGGCCTACTTCTTTCATGCTAGAGAACATCTTT

Reverse complement sequence

AAAGATGTTCTCTAGCATGAAAGAAGTAGGCCGAAAGGTGATTAATAAACAGAAACATGTTCTACATCGCTCAAGGAAGACCCCTAATTGTAATTGCCCC[G/A]
CAACAGTCACCTTGTCATTAAGTAAGCAAGATGACCTAGGTAAAAGTGTTTTTATGAAGGCAAAGAGTGAAATCTTCAACTCGGTATCAGATGCTACACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 12.90% 6.69% 10.37% NA
All Indica  2759 77.70% 2.10% 8.81% 11.31% NA
All Japonica  1512 67.30% 30.80% 1.72% 0.13% NA
Aus  269 21.90% 0.40% 15.24% 62.45% NA
Indica I  595 88.70% 0.70% 2.52% 8.07% NA
Indica II  465 79.60% 2.40% 14.84% 3.23% NA
Indica III  913 68.10% 1.40% 11.83% 18.62% NA
Indica Intermediate  786 79.50% 3.90% 6.49% 10.05% NA
Temperate Japonica  767 96.50% 2.50% 1.04% 0.00% NA
Tropical Japonica  504 23.40% 74.20% 1.98% 0.40% NA
Japonica Intermediate  241 66.40% 30.30% 3.32% 0.00% NA
VI/Aromatic  96 30.20% 68.80% 0.00% 1.04% NA
Intermediate  90 64.40% 21.10% 6.67% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0511832236 C -> T LOC_Os05g20200.1 upstream_gene_variant ; 3481.0bp to feature; MODIFIER silent_mutation Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0511832236 C -> T LOC_Os05g20210.1 downstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0511832236 C -> T LOC_Os05g20200-LOC_Os05g20210 intergenic_region ; MODIFIER silent_mutation Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N
vg0511832236 C -> DEL N N silent_mutation Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0511832236 NA 8.10E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 1.34E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 2.89E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 2.94E-14 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 1.19E-20 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 1.91E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 8.25E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 2.38E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 3.13E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 9.95E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 1.55E-07 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 1.75E-21 mr1593_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 8.73E-06 9.70E-30 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 6.21E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236 NA 9.72E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251