Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511832236:

Variant ID: vg0511832236 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 11832236
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTGTAGCATCTGATACCGAGTTGAAGATTTCACTCTTTGCCTTCATAAAAACACTTTTACCTAGGTCATCTTGCTTACTTAATGACAAGGTGACTGTTG[C/T]
GGGGCAATTACAATTAGGGGTCTTCCTTGAGCGATGTAGAACATGTTTCTGTTTATTAATCACCTTTCGGCCTACTTCTTTCATGCTAGAGAACATCTTT

Reverse complement sequence

AAAGATGTTCTCTAGCATGAAAGAAGTAGGCCGAAAGGTGATTAATAAACAGAAACATGTTCTACATCGCTCAAGGAAGACCCCTAATTGTAATTGCCCC[G/A]
CAACAGTCACCTTGTCATTAAGTAAGCAAGATGACCTAGGTAAAAGTGTTTTTATGAAGGCAAAGAGTGAAATCTTCAACTCGGTATCAGATGCTACACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	12.90%	6.69%	10.37%	NA
All Indica	2759	77.70%	2.10%	8.81%	11.31%	NA
All Japonica	1512	67.30%	30.80%	1.72%	0.13%	NA
Aus	269	21.90%	0.40%	15.24%	62.45%	NA
Indica I	595	88.70%	0.70%	2.52%	8.07%	NA
Indica II	465	79.60%	2.40%	14.84%	3.23%	NA
Indica III	913	68.10%	1.40%	11.83%	18.62%	NA
Indica Intermediate	786	79.50%	3.90%	6.49%	10.05%	NA
Temperate Japonica	767	96.50%	2.50%	1.04%	0.00%	NA
Tropical Japonica	504	23.40%	74.20%	1.98%	0.40%	NA
Japonica Intermediate	241	66.40%	30.30%	3.32%	0.00%	NA
VI/Aromatic	96	30.20%	68.80%	0.00%	1.04%	NA
Intermediate	90	64.40%	21.10%	6.67%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0511832236	C -> T	LOC_Os05g20200.1	upstream_gene_variant ; 3481.0bp to feature; MODIFIER	silent_mutation	Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg0511832236	C -> T	LOC_Os05g20210.1	downstream_gene_variant ; 1520.0bp to feature; MODIFIER	silent_mutation	Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg0511832236	C -> T	LOC_Os05g20200-LOC_Os05g20210	intergenic_region ; MODIFIER	silent_mutation	Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N
vg0511832236	C -> DEL	N	N	silent_mutation	Average:25.239; most accessible tissue: Zhenshan97 flag leaf, score: 37.1	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0511832236	NA	8.10E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	1.34E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	2.89E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	2.94E-14	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	1.19E-20	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	1.91E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	8.25E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	2.38E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	3.13E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	9.95E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	1.55E-07	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	1.75E-21	mr1593_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	8.73E-06	9.70E-30	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	6.21E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511832236	NA	9.72E-07	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251