\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511479803:

Variant ID: vg0511479803 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 11479803
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGACGGTTACGACGGTTGAAAAGGTCGATAATACCCACCAACCGTTATTGGGGAGTCATCTCAGCCATTCCTCCAATTCCTGGATCAAACGGCCGAGA[G/T]
GGGGTTTCGGCCAAACCCGAGGTTTGGCCGAACAGGAGCTGGCCCAACCAGCCCACGGTTTGGCTGGCGGCCTCCTCTCTTGATTCTTGGATTCTTGTTG

Reverse complement sequence

CAACAAGAATCCAAGAATCAAGAGAGGAGGCCGCCAGCCAAACCGTGGGCTGGTTGGGCCAGCTCCTGTTCGGCCAAACCTCGGGTTTGGCCGAAACCCC[C/A]
TCTCGGCCGTTTGATCCAGGAATTGGAGGAATGGCTGAGATGACTCCCCAATAACGGTTGGTGGGTATTATCGACCTTTTCAACCGTCGTAACCGTCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 9.80% 4.49% 0.00% NA
All Indica  2759 95.10% 1.10% 3.84% 0.00% NA
All Japonica  1512 65.30% 28.00% 6.61% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 90.40% 0.00% 9.58% 0.00% NA
Indica II  465 94.60% 1.70% 3.66% 0.00% NA
Indica III  913 99.20% 0.20% 0.55% 0.00% NA
Indica Intermediate  786 94.00% 2.50% 3.44% 0.00% NA
Temperate Japonica  767 91.00% 2.30% 6.65% 0.00% NA
Tropical Japonica  504 25.20% 69.00% 5.75% 0.00% NA
Japonica Intermediate  241 67.60% 24.10% 8.30% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0511479803 G -> T LOC_Os05g19690.1 downstream_gene_variant ; 1772.0bp to feature; MODIFIER silent_mutation Average:57.21; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N
vg0511479803 G -> T LOC_Os05g19680-LOC_Os05g19690 intergenic_region ; MODIFIER silent_mutation Average:57.21; most accessible tissue: Zhenshan97 panicle, score: 77.482 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0511479803 NA 1.40E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0511479803 NA 2.63E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 3.03E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 6.81E-08 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 2.56E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 1.20E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 4.11E-10 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 1.77E-23 mr1593 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 4.02E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 7.52E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 5.63E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 1.23E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 1.39E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 5.83E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 7.19E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 3.19E-16 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 7.78E-08 6.05E-34 mr1593_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 4.96E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 2.84E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511479803 NA 1.50E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251