\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0511189064:

Variant ID: vg0511189064 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 11189064
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AAATATGCCGATTTATGACCATATTTCCAACAGATATAAGCATAATTAGCATACTATGACACCAGTAAATACGTTATAACACCAATGAATCAATTTTCTG[A/G]
TCCGCTCCTTACCGCAATGAATGAGATGAAAACATATTAGTACGATCAGAAAATCGCGTGGAAAAAATTACGCGGACGGTCAAAAACAGATTACGAGGAA

Reverse complement sequence

TTCCTCGTAATCTGTTTTTGACCGTCCGCGTAATTTTTTCCACGCGATTTTCTGATCGTACTAATATGTTTTCATCTCATTCATTGCGGTAAGGAGCGGA[T/C]
CAGAAAATTGATTCATTGGTGTTATAACGTATTTACTGGTGTCATAGTATGCTAATTATGCTTATATCTGTTGGAAATATGGTCATAAATCGGCATATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 14.50% 1.46% 0.13% NA
All Indica  2759 74.80% 22.70% 2.25% 0.22% NA
All Japonica  1512 99.40% 0.40% 0.20% 0.00% NA
Aus  269 83.60% 16.00% 0.37% 0.00% NA
Indica I  595 87.70% 10.10% 1.85% 0.34% NA
Indica II  465 72.90% 24.50% 2.58% 0.00% NA
Indica III  913 69.70% 28.80% 1.31% 0.22% NA
Indica Intermediate  786 72.30% 24.00% 3.44% 0.25% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0511189064 A -> DEL N N silent_mutation Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0511189064 A -> G LOC_Os05g19270.1 upstream_gene_variant ; 351.0bp to feature; MODIFIER silent_mutation Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0511189064 A -> G LOC_Os05g19250.1 downstream_gene_variant ; 2574.0bp to feature; MODIFIER silent_mutation Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0511189064 A -> G LOC_Os05g19260.1 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0511189064 A -> G LOC_Os05g19260-LOC_Os05g19270 intergenic_region ; MODIFIER silent_mutation Average:87.216; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0511189064 NA 7.64E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 NA 7.96E-08 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 NA 1.03E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 NA 6.56E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 NA 2.12E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 NA 3.67E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 7.62E-06 NA mr1897 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0511189064 9.57E-06 2.70E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251