\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0510444945:

Variant ID: vg0510444945 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 10444945
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGGAGCCGGCGAGGAGGAGCGGCCGACCGAAGGGACGTCGGCGACGACGAGGATGGAGAGGAGGCGATGCCGAGGACGATGTCACCAGTTCGCCGCTG[C/G]
GATGCCGGAGGTGGTGGTGGCGCGGCCGACGGCGCACGGGTAGAGGAAGGGCCAACCGGGGAAATTCCGGCGAGGTGGATGGAGAGGCCGGCACGGCACG

Reverse complement sequence

CGTGCCGTGCCGGCCTCTCCATCCACCTCGCCGGAATTTCCCCGGTTGGCCCTTCCTCTACCCGTGCGCCGTCGGCCGCGCCACCACCACCTCCGGCATC[G/C]
CAGCGGCGAACTGGTGACATCGTCCTCGGCATCGCCTCCTCTCCATCCTCGTCGTCGCCGACGTCCCTTCGGTCGGCCGCTCCTCCTCGCCGGCTCCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 9.10% 0.57% 0.04% NA
All Indica  2759 91.20% 8.10% 0.76% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 24.20% 73.20% 2.23% 0.37% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 81.10% 17.00% 1.97% 0.00% NA
Indica Intermediate  786 91.50% 8.10% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0510444945 C -> DEL LOC_Os05g18170.1 N frameshift_variant Average:76.143; most accessible tissue: Minghui63 young leaf, score: 92.217 N N N N
vg0510444945 C -> G LOC_Os05g18170.1 missense_variant ; p.Cys72Trp; MODERATE nonsynonymous_codon ; C72W Average:76.143; most accessible tissue: Minghui63 young leaf, score: 92.217 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0510444945 C G -0.01 -0.01 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0510444945 NA 7.18E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 4.24E-06 NA mr1304_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 5.26E-07 NA mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 5.76E-10 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 2.91E-06 NA mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 3.01E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 2.14E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 1.20E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 5.07E-11 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 4.22E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0510444945 NA 3.18E-11 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251