\
| Variant ID: vg0509310393 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9310393 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 300. )
CAAACGACATTTTTCGGTATGGGCACGTGAATGTAGTCTTAATTTGATCATCGGGATGAATGGGGATTTGGTGATAACCAGAATACCCATTAAGGAAACA[A/G]
AAGAAGGAATGGTTCGCTAGCCGCTCAAGCATTTCATCAATGAAAGGCAGCGGAAAGTGATCCTTCTTCGTAGCCTTGTTGAGTTTCCTATAGTCAATGC
GCATTGACTATAGGAAACTCAACAAGGCTACGAAGAAGGATCACTTTCCGCTGCCTTTCATTGATGAAATGCTTGAGCGGCTAGCGAACCATTCCTTCTT[T/C]
TGTTTCCTTAATGGGTATTCTGGTTATCACCAAATCCCCATTCATCCCGATGATCAAATTAAGACTACATTCACGTGCCCATACCGAAAAATGTCGTTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 9.90% | 1.59% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.00% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 67.70% | 28.70% | 3.57% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 2.20% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 2.70% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 24.40% | 69.40% | 6.15% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 26.10% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 6.70% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509310393 | A -> G | LOC_Os05g16410.1 | downstream_gene_variant ; 251.0bp to feature; MODIFIER | silent_mutation | Average:42.679; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0509310393 | A -> G | LOC_Os05g16400-LOC_Os05g16410 | intergenic_region ; MODIFIER | silent_mutation | Average:42.679; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509310393 | 9.92E-08 | NA | mr1082 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 5.08E-09 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 5.95E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | 9.49E-07 | NA | mr1107 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 5.19E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 3.01E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 1.45E-06 | mr1870 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 3.57E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 3.74E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509310393 | NA | 3.99E-13 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |