Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508890508:

Variant ID: vg0508890508 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8890508
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTATTAACCTTTATATGCACCCATGTTCTATTCAACATATCTTTTACGATATTTTGCAGATCTCTAGCACCCTTGGTTGCTGTATTTATGGGAAAGG[G/A]
TTCCCAAAAATAAATTAGCTTGAAAGCAATTAAAGAGTTTGCTAACGATAACGATATGATGTGAGATGTAGTTCCTAGGGAGATGGAGCCATCAAAGAAT

Reverse complement sequence

ATTCTTTGATGGCTCCATCTCCCTAGGAACTACATCTCACATCATATCGTTATCGTTAGCAAACTCTTTAATTGCTTTCAAGCTAATTTATTTTTGGGAA[C/T]
CCTTTCCCATAAATACAGCAACCAAGGGTGCTAGAGATCTGCAAAATATCGTAAAAGATATGTTGAATAGAACATGGGTGCATATAAAGGTTAATAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	8.40%	4.17%	6.98%	NA
All Indica	2759	91.80%	1.10%	1.34%	5.80%	NA
All Japonica	1512	67.30%	23.90%	8.40%	0.46%	NA
Aus	269	30.90%	0.00%	9.29%	59.85%	NA
Indica I	595	97.50%	0.00%	2.52%	0.00%	NA
Indica II	465	96.60%	1.90%	0.86%	0.65%	NA
Indica III	913	88.10%	0.20%	0.66%	11.06%	NA
Indica Intermediate	786	88.90%	2.40%	1.53%	7.12%	NA
Temperate Japonica	767	87.20%	2.60%	10.17%	0.00%	NA
Tropical Japonica	504	35.30%	57.90%	5.56%	1.19%	NA
Japonica Intermediate	241	70.50%	20.30%	8.71%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	84.40%	5.60%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508890508	G -> DEL	N	N	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N
vg0508890508	G -> A	LOC_Os05g15730.1	upstream_gene_variant ; 1110.0bp to feature; MODIFIER	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N
vg0508890508	G -> A	LOC_Os05g15750.1	upstream_gene_variant ; 266.0bp to feature; MODIFIER	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N
vg0508890508	G -> A	LOC_Os05g15720.1	downstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N
vg0508890508	G -> A	LOC_Os05g15740.1	downstream_gene_variant ; 199.0bp to feature; MODIFIER	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N
vg0508890508	G -> A	LOC_Os05g15740-LOC_Os05g15750	intergenic_region ; MODIFIER	silent_mutation	Average:45.821; most accessible tissue: Callus, score: 72.852	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508890508	NA	5.11E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	5.89E-13	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	3.60E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.09E-09	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.60E-09	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	9.81E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	3.02E-20	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	2.49E-10	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	3.84E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	7.34E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	2.43E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.85E-06	mr1425_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	6.05E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.91E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.73E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	8.76E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	4.44E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	7.09E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	3.27E-06	9.66E-16	mr1993_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508890508	NA	2.61E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251