\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508342418:

Variant ID: vg0508342418 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8342418
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACTATTTATAGCTCCATTACAGGTTCTTACTACTAGGGTTTAGGTTGTACAGGGAAATTTACATGATTACCCTTACAAAAGGGACATTTATAGGGGTA[C/T]
ATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGGCGATCGCCGGCCCTATAGCCCTTAGGCTTGATGGGCCGGAAAGGCTTCCTCGGCCCTC

Reverse complement sequence

GAGGGCCGAGGAAGCCTTTCCGGCCCATCAAGCCTAAGGGCTATAGGGCCGGCGATCGCCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTAT[G/A]
TACCCCTATAAATGTCCCTTTTGTAAGGGTAATCATGTAAATTTCCCTGTACAACCTAAACCCTAGTAGTAAGAACCTGTAATGGAGCTATAAATAGTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.70% 8.10% 7.49% 32.65% NA
All Indica  2759 27.70% 13.80% 11.31% 47.15% NA
All Japonica  1512 99.10% 0.10% 0.26% 0.60% NA
Aus  269 9.30% 0.00% 11.15% 79.55% NA
Indica I  595 36.80% 10.80% 9.41% 43.03% NA
Indica II  465 31.20% 28.20% 6.24% 34.41% NA
Indica III  913 17.30% 14.90% 14.35% 53.45% NA
Indica Intermediate  786 30.80% 6.50% 12.21% 50.51% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 97.80% 0.00% 0.60% 1.59% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 70.00% 2.20% 8.89% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508342418 C -> T LOC_Os05g14670.1 upstream_gene_variant ; 283.0bp to feature; MODIFIER silent_mutation Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0508342418 C -> T LOC_Os05g14660.1 downstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0508342418 C -> T LOC_Os05g14670-LOC_Os05g14690 intergenic_region ; MODIFIER silent_mutation Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N
vg0508342418 C -> DEL N N silent_mutation Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508342418 NA 2.54E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508342418 NA 5.91E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508342418 9.25E-08 NA mr1514_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508342418 3.93E-07 2.62E-07 mr1514_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508342418 NA 4.68E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251