\
| Variant ID: vg0508342418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 8342418 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGACTATTTATAGCTCCATTACAGGTTCTTACTACTAGGGTTTAGGTTGTACAGGGAAATTTACATGATTACCCTTACAAAAGGGACATTTATAGGGGTA[C/T]
ATAATGTTATAGGGGCTCATGGGCCCCTGATGGGCCGTCTGGCGATCGCCGGCCCTATAGCCCTTAGGCTTGATGGGCCGGAAAGGCTTCCTCGGCCCTC
GAGGGCCGAGGAAGCCTTTCCGGCCCATCAAGCCTAAGGGCTATAGGGCCGGCGATCGCCAGACGGCCCATCAGGGGCCCATGAGCCCCTATAACATTAT[G/A]
TACCCCTATAAATGTCCCTTTTGTAAGGGTAATCATGTAAATTTCCCTGTACAACCTAAACCCTAGTAGTAAGAACCTGTAATGGAGCTATAAATAGTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 8.10% | 7.49% | 32.65% | NA |
| All Indica | 2759 | 27.70% | 13.80% | 11.31% | 47.15% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.26% | 0.60% | NA |
| Aus | 269 | 9.30% | 0.00% | 11.15% | 79.55% | NA |
| Indica I | 595 | 36.80% | 10.80% | 9.41% | 43.03% | NA |
| Indica II | 465 | 31.20% | 28.20% | 6.24% | 34.41% | NA |
| Indica III | 913 | 17.30% | 14.90% | 14.35% | 53.45% | NA |
| Indica Intermediate | 786 | 30.80% | 6.50% | 12.21% | 50.51% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.60% | 1.59% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 70.00% | 2.20% | 8.89% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0508342418 | C -> T | LOC_Os05g14670.1 | upstream_gene_variant ; 283.0bp to feature; MODIFIER | silent_mutation | Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0508342418 | C -> T | LOC_Os05g14660.1 | downstream_gene_variant ; 2741.0bp to feature; MODIFIER | silent_mutation | Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0508342418 | C -> T | LOC_Os05g14670-LOC_Os05g14690 | intergenic_region ; MODIFIER | silent_mutation | Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0508342418 | C -> DEL | N | N | silent_mutation | Average:39.549; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0508342418 | NA | 2.54E-08 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508342418 | NA | 5.91E-08 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508342418 | 9.25E-08 | NA | mr1514_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508342418 | 3.93E-07 | 2.62E-07 | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508342418 | NA | 4.68E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |