\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508324298:

Variant ID: vg0508324298 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8324298
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGTATTGGGCCTTCCCATCGTGGGCTTTTTACTGTGCTGCTCGATCGGTGGGAATTTACCGTTTCGCCTACCTTTGCGACACGTGGCGCTTTATTAC[T/A]
GGTGGGTAGGCGAACGGTCGCCTGGGTGGGCTATATATTCCCACTGCTCTTTCCTTTTCACCACCACACTTGCCATTTTACCGTGCGCGCTCTCTTCCTC

Reverse complement sequence

GAGGAAGAGAGCGCGCACGGTAAAATGGCAAGTGTGGTGGTGAAAAGGAAAGAGCAGTGGGAATATATAGCCCACCCAGGCGACCGTTCGCCTACCCACC[A/T]
GTAATAAAGCGCCACGTGTCGCAAAGGTAGGCGAAACGGTAAATTCCCACCGATCGAGCAGCACAGTAAAAAGCCCACGATGGGAAGGCCCAATACTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.10% 0.19% 0.00% NA
All Indica  2759 42.90% 56.80% 0.33% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 42.00% 57.60% 0.34% 0.00% NA
Indica II  465 57.40% 42.40% 0.22% 0.00% NA
Indica III  913 41.20% 58.30% 0.55% 0.00% NA
Indica Intermediate  786 36.90% 63.00% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508324298 T -> A LOC_Os05g14600.1 upstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0508324298 T -> A LOC_Os05g14610.1 upstream_gene_variant ; 185.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0508324298 T -> A LOC_Os05g14590.1 downstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0508324298 T -> A LOC_Os05g14620.1 downstream_gene_variant ; 4356.0bp to feature; MODIFIER silent_mutation Average:28.418; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0508324298 T -> A LOC_Os05g14600-LOC_Os05g14610 intergenic_region ; MODIFIER silent_mutation Average:28.418; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508324298 NA 4.97E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508324298 5.94E-07 NA mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508324298 1.18E-07 5.59E-10 mr1593 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508324298 NA 1.23E-11 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251