Variant ID: vg0508131496 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 8131496 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACGAGCATCTGTCGGGTGTCGAATCATCCCATCCTTCTTGCGCCCTTCTTCATGCCAGTGCATTAGTTCCGCATCTCGCGGGTTTGATTATATCCGTTTA[A/T]
TGCGGTCTTTGACAGGAAGGTACCACATCACAAGCTGCGGGATTTGTCTCTGTCGTCCCTCAGTTGCTTCAGAGGGTTCTAGGCTAGTATTGCTATTCGA
TCGAATAGCAATACTAGCCTAGAACCCTCTGAAGCAACTGAGGGACGACAGAGACAAATCCCGCAGCTTGTGATGTGGTACCTTCCTGTCAAAGACCGCA[T/A]
TAAACGGATATAATCAAACCCGCGAGATGCGGAACTAATGCACTGGCATGAAGAAGGGCGCAAGAAGGATGGGATGATTCGACACCCGACAGATGCTCGT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.70% | 1.70% | 1.63% | 0.00% | NA |
All Indica | 2759 | 99.10% | 0.20% | 0.72% | 0.00% | NA |
All Japonica | 1512 | 91.50% | 5.00% | 3.57% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
Indica I | 595 | 96.60% | 0.80% | 2.52% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 93.10% | 2.30% | 4.56% | 0.00% | NA |
Tropical Japonica | 504 | 91.90% | 6.20% | 1.98% | 0.00% | NA |
Japonica Intermediate | 241 | 85.50% | 10.80% | 3.73% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0508131496 | A -> T | LOC_Os05g14410.1 | upstream_gene_variant ; 4310.0bp to feature; MODIFIER | silent_mutation | Average:19.236; most accessible tissue: Callus, score: 36.827 | N | N | N | N |
vg0508131496 | A -> T | LOC_Os05g14420.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.236; most accessible tissue: Callus, score: 36.827 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0508131496 | 3.08E-06 | NA | mr1552 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508131496 | NA | 7.80E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508131496 | NA | 6.82E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508131496 | 1.91E-06 | 1.91E-06 | mr1173_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508131496 | NA | 1.57E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |