Variant ID: vg0508127869 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 8127869 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCACCCCTCATGCCCATTCACACCCACATGCACACACATATATACCCCCTCACACCCACATGCACACACATATAAAAGGAAACACCCACATGCACGCAC[G/A]
TCCGTGTTCGACGAACGGCCGACGACGAGCTTCGGTCGTGGATGACGAAGGAAGTGCCGGCGACGAGGTTCGGCCGTGGACGACGACCGGCTTCGGCCGT
ACGGCCGAAGCCGGTCGTCGTCCACGGCCGAACCTCGTCGCCGGCACTTCCTTCGTCATCCACGACCGAAGCTCGTCGTCGGCCGTTCGTCGAACACGGA[C/T]
GTGCGTGCATGTGGGTGTTTCCTTTTATATGTGTGTGCATGTGGGTGTGAGGGGGTATATATGTGTGTGCATGTGGGTGTGAATGGGCATGAGGGGTGGG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.10% | 2.90% | 1.04% | 0.00% | NA |
All Indica | 2759 | 93.30% | 5.00% | 1.78% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.20% | 1.70% | 0.17% | 0.00% | NA |
Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
Indica III | 913 | 91.60% | 5.00% | 3.40% | 0.00% | NA |
Indica Intermediate | 786 | 88.30% | 9.70% | 2.04% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0508127869 | G -> A | LOC_Os05g14410.1 | upstream_gene_variant ; 683.0bp to feature; MODIFIER | silent_mutation | Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
vg0508127869 | G -> A | LOC_Os05g14420.1 | downstream_gene_variant ; 1121.0bp to feature; MODIFIER | silent_mutation | Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
vg0508127869 | G -> A | LOC_Os05g14410-LOC_Os05g14420 | intergenic_region ; MODIFIER | silent_mutation | Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0508127869 | NA | 1.92E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 2.21E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 5.14E-08 | mr1364_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 4.94E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 9.52E-06 | mr1442_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 4.91E-06 | mr1469_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0508127869 | NA | 2.47E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |