\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508127869:

Variant ID: vg0508127869 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8127869
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACCCCTCATGCCCATTCACACCCACATGCACACACATATATACCCCCTCACACCCACATGCACACACATATAAAAGGAAACACCCACATGCACGCAC[G/A]
TCCGTGTTCGACGAACGGCCGACGACGAGCTTCGGTCGTGGATGACGAAGGAAGTGCCGGCGACGAGGTTCGGCCGTGGACGACGACCGGCTTCGGCCGT

Reverse complement sequence

ACGGCCGAAGCCGGTCGTCGTCCACGGCCGAACCTCGTCGCCGGCACTTCCTTCGTCATCCACGACCGAAGCTCGTCGTCGGCCGTTCGTCGAACACGGA[C/T]
GTGCGTGCATGTGGGTGTTTCCTTTTATATGTGTGTGCATGTGGGTGTGAGGGGGTATATATGTGTGTGCATGTGGGTGTGAATGGGCATGAGGGGTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.90% 1.04% 0.00% NA
All Indica  2759 93.30% 5.00% 1.78% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 91.60% 5.00% 3.40% 0.00% NA
Indica Intermediate  786 88.30% 9.70% 2.04% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508127869 G -> A LOC_Os05g14410.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0508127869 G -> A LOC_Os05g14420.1 downstream_gene_variant ; 1121.0bp to feature; MODIFIER silent_mutation Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0508127869 G -> A LOC_Os05g14410-LOC_Os05g14420 intergenic_region ; MODIFIER silent_mutation Average:47.516; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508127869 NA 1.92E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 2.21E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 5.14E-08 mr1364_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 4.94E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 9.52E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 4.91E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508127869 NA 2.47E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251