Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0508113074:

Variant ID: vg0508113074 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8113074
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCGGTCTGACCGCTCCTCATGAGCCGGTCTGACCGGAGGTGTGCCGGTGGTCTGACCGGCCTGGCGCCCGGTCTGACCGGTTGAGCCGATCTCGTCGTC[G/A]
TAGTCATCGTCGCTCTCGTCTTCAAAAATACGACCATCCTCCCCCTGAACCTGTGACAGTGTACCTGCAATATCGGCTCTAGTACCTGGACTAGCCTCAT

Reverse complement sequence

ATGAGGCTAGTCCAGGTACTAGAGCCGATATTGCAGGTACACTGTCACAGGTTCAGGGGGAGGATGGTCGTATTTTTGAAGACGAGAGCGACGATGACTA[C/T]
GACGACGAGATCGGCTCAACCGGTCAGACCGGGCGCCAGGCCGGTCAGACCACCGGCACACCTCCGGTCAGACCGGCTCATGAGGAGCGGTCAGACCGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	13.20%	1.65%	21.50%	NA
All Indica	2759	39.00%	22.40%	2.75%	35.85%	NA
All Japonica	1512	99.70%	0.10%	0.00%	0.20%	NA
Aus	269	94.10%	0.40%	0.00%	5.58%	NA
Indica I	595	40.30%	13.30%	3.87%	42.52%	NA
Indica II	465	34.60%	28.80%	3.44%	33.12%	NA
Indica III	913	40.50%	26.70%	1.31%	31.43%	NA
Indica Intermediate	786	38.90%	20.40%	3.18%	37.53%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	4.40%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508113074	G -> DEL	LOC_Os05g14400.1	N	frameshift_variant	Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0508113074	G -> A	LOC_Os05g14400.1	synonymous_variant ; p.Tyr936Tyr; LOW	synonymous_codon	Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508113074	NA	5.74E-27	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	NA	1.04E-12	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	NA	1.16E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	NA	1.69E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	NA	4.73E-12	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	NA	4.50E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074	2.49E-06	NA	mr1798_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251