\
| Variant ID: vg0508113074 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 8113074 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCGGTCTGACCGCTCCTCATGAGCCGGTCTGACCGGAGGTGTGCCGGTGGTCTGACCGGCCTGGCGCCCGGTCTGACCGGTTGAGCCGATCTCGTCGTC[G/A]
TAGTCATCGTCGCTCTCGTCTTCAAAAATACGACCATCCTCCCCCTGAACCTGTGACAGTGTACCTGCAATATCGGCTCTAGTACCTGGACTAGCCTCAT
ATGAGGCTAGTCCAGGTACTAGAGCCGATATTGCAGGTACACTGTCACAGGTTCAGGGGGAGGATGGTCGTATTTTTGAAGACGAGAGCGACGATGACTA[C/T]
GACGACGAGATCGGCTCAACCGGTCAGACCGGGCGCCAGGCCGGTCAGACCACCGGCACACCTCCGGTCAGACCGGCTCATGAGGAGCGGTCAGACCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 13.20% | 1.65% | 21.50% | NA |
| All Indica | 2759 | 39.00% | 22.40% | 2.75% | 35.85% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.00% | 0.20% | NA |
| Aus | 269 | 94.10% | 0.40% | 0.00% | 5.58% | NA |
| Indica I | 595 | 40.30% | 13.30% | 3.87% | 42.52% | NA |
| Indica II | 465 | 34.60% | 28.80% | 3.44% | 33.12% | NA |
| Indica III | 913 | 40.50% | 26.70% | 1.31% | 31.43% | NA |
| Indica Intermediate | 786 | 38.90% | 20.40% | 3.18% | 37.53% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 4.40% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0508113074 | G -> DEL | LOC_Os05g14400.1 | N | frameshift_variant | Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| vg0508113074 | G -> A | LOC_Os05g14400.1 | synonymous_variant ; p.Tyr936Tyr; LOW | synonymous_codon | Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0508113074 | NA | 5.74E-27 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | NA | 1.04E-12 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | NA | 1.16E-08 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | NA | 1.69E-27 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | NA | 4.73E-12 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | NA | 4.50E-10 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508113074 | 2.49E-06 | NA | mr1798_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |