\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508113074:

Variant ID: vg0508113074 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8113074
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGTCTGACCGCTCCTCATGAGCCGGTCTGACCGGAGGTGTGCCGGTGGTCTGACCGGCCTGGCGCCCGGTCTGACCGGTTGAGCCGATCTCGTCGTC[G/A]
TAGTCATCGTCGCTCTCGTCTTCAAAAATACGACCATCCTCCCCCTGAACCTGTGACAGTGTACCTGCAATATCGGCTCTAGTACCTGGACTAGCCTCAT

Reverse complement sequence

ATGAGGCTAGTCCAGGTACTAGAGCCGATATTGCAGGTACACTGTCACAGGTTCAGGGGGAGGATGGTCGTATTTTTGAAGACGAGAGCGACGATGACTA[C/T]
GACGACGAGATCGGCTCAACCGGTCAGACCGGGCGCCAGGCCGGTCAGACCACCGGCACACCTCCGGTCAGACCGGCTCATGAGGAGCGGTCAGACCGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 13.20% 1.65% 21.50% NA
All Indica  2759 39.00% 22.40% 2.75% 35.85% NA
All Japonica  1512 99.70% 0.10% 0.00% 0.20% NA
Aus  269 94.10% 0.40% 0.00% 5.58% NA
Indica I  595 40.30% 13.30% 3.87% 42.52% NA
Indica II  465 34.60% 28.80% 3.44% 33.12% NA
Indica III  913 40.50% 26.70% 1.31% 31.43% NA
Indica Intermediate  786 38.90% 20.40% 3.18% 37.53% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 4.40% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508113074 G -> DEL LOC_Os05g14400.1 N frameshift_variant Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N
vg0508113074 G -> A LOC_Os05g14400.1 synonymous_variant ; p.Tyr936Tyr; LOW synonymous_codon Average:46.121; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508113074 NA 5.74E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 NA 1.04E-12 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 NA 1.16E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 NA 1.69E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 NA 4.73E-12 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 NA 4.50E-10 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508113074 2.49E-06 NA mr1798_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251