\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507866014:

Variant ID: vg0507866014 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7866014
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTAATATCGGCATTGGGAAAGAAGATTAGATTGAAGCGAAGTCGGAGGCGGAGATCGAGTTCGGAAACAGAGCAGGATCGGCTGGAGTCCAGATCGGCTA[C/T]
GATAAGATCAGCTGAGTCTGAGTCGGACTAGGTAAGCCGATGTAGCCGATCCTAGCAATACAACTTGATGTGTGATGTCAGGTTGGATTGAGGTCTTCAA

Reverse complement sequence

TTGAAGACCTCAATCCAACCTGACATCACACATCAAGTTGTATTGCTAGGATCGGCTACATCGGCTTACCTAGTCCGACTCAGACTCAGCTGATCTTATC[G/A]
TAGCCGATCTGGACTCCAGCCGATCCTGCTCTGTTTCCGAACTCGATCTCCGCCTCCGACTTCGCTTCAATCTAATCTTCTTTCCCAATGCCGATATTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.80% 46.00% 0.21% 0.00% NA
All Indica  2759 82.70% 17.00% 0.29% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 95.80% 3.50% 0.67% 0.00% NA
Indica II  465 68.20% 31.60% 0.22% 0.00% NA
Indica III  913 80.90% 18.90% 0.11% 0.00% NA
Indica Intermediate  786 83.60% 16.20% 0.25% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507866014 C -> T LOC_Os05g14070.1 upstream_gene_variant ; 2242.0bp to feature; MODIFIER silent_mutation Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0507866014 C -> T LOC_Os05g14090.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0507866014 C -> T LOC_Os05g14080.1 downstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0507866014 C -> T LOC_Os05g14080-LOC_Os05g14090 intergenic_region ; MODIFIER silent_mutation Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507866014 NA 5.77E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 NA 2.85E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 2.28E-06 7.42E-31 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 2.59E-07 4.85E-10 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 NA 7.62E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 NA 1.19E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 9.82E-06 9.02E-28 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 NA 1.42E-12 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 1.18E-06 2.07E-34 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507866014 2.65E-06 5.13E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251