\
| Variant ID: vg0507866014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7866014 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 109. )
GTAATATCGGCATTGGGAAAGAAGATTAGATTGAAGCGAAGTCGGAGGCGGAGATCGAGTTCGGAAACAGAGCAGGATCGGCTGGAGTCCAGATCGGCTA[C/T]
GATAAGATCAGCTGAGTCTGAGTCGGACTAGGTAAGCCGATGTAGCCGATCCTAGCAATACAACTTGATGTGTGATGTCAGGTTGGATTGAGGTCTTCAA
TTGAAGACCTCAATCCAACCTGACATCACACATCAAGTTGTATTGCTAGGATCGGCTACATCGGCTTACCTAGTCCGACTCAGACTCAGCTGATCTTATC[G/A]
TAGCCGATCTGGACTCCAGCCGATCCTGCTCTGTTTCCGAACTCGATCTCCGCCTCCGACTTCGCTTCAATCTAATCTTCTTTCCCAATGCCGATATTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 46.00% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 82.70% | 17.00% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 3.50% | 0.67% | 0.00% | NA |
| Indica II | 465 | 68.20% | 31.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 80.90% | 18.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 55.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507866014 | C -> T | LOC_Os05g14070.1 | upstream_gene_variant ; 2242.0bp to feature; MODIFIER | silent_mutation | Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0507866014 | C -> T | LOC_Os05g14090.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0507866014 | C -> T | LOC_Os05g14080.1 | downstream_gene_variant ; 274.0bp to feature; MODIFIER | silent_mutation | Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0507866014 | C -> T | LOC_Os05g14080-LOC_Os05g14090 | intergenic_region ; MODIFIER | silent_mutation | Average:38.444; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507866014 | NA | 5.77E-26 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | NA | 2.85E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | 2.28E-06 | 7.42E-31 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | 2.59E-07 | 4.85E-10 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | NA | 7.62E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | NA | 1.19E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | 9.82E-06 | 9.02E-28 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | NA | 1.42E-12 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | 1.18E-06 | 2.07E-34 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507866014 | 2.65E-06 | 5.13E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |