\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507786958:

Variant ID: vg0507786958 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7786958
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTGGATTAATAGAATCAACCTGCTCACAACAAATTGCAAGCTCTGAACTATCAAGAGCTATAGGTAGCAGTAAATTGCTGAACTGAGCATCACGACT[C/T]
ATGGTCATGGGGAGTTTCAGAATAGAGCACAGAAAATTTCTTGGCAATCTAGAGACAGTACAAAAAGGTGATCACGGCCTGTTATGTTCTTCCATGGATT

Reverse complement sequence

AATCCATGGAAGAACATAACAGGCCGTGATCACCTTTTTGTACTGTCTCTAGATTGCCAAGAAATTTTCTGTGCTCTATTCTGAAACTCCCCATGACCAT[G/A]
AGTCGTGATGCTCAGTTCAGCAATTTACTGCTACCTATAGCTCTTGATAGTTCAGAGCTTGCAATTTGTTGTGAGCAGGTTGATTCTATTAATCCAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 7.60% 1.06% 0.00% NA
All Indica  2759 99.10% 0.80% 0.07% 0.00% NA
All Japonica  1512 75.10% 22.00% 2.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 93.90% 2.90% 3.26% 0.00% NA
Tropical Japonica  504 43.80% 53.20% 2.98% 0.00% NA
Japonica Intermediate  241 80.50% 17.40% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 6.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507786958 C -> T LOC_Os05g13980.1 upstream_gene_variant ; 1632.0bp to feature; MODIFIER silent_mutation Average:59.652; most accessible tissue: Callus, score: 81.664 N N N N
vg0507786958 C -> T LOC_Os05g13990.1 upstream_gene_variant ; 1347.0bp to feature; MODIFIER silent_mutation Average:59.652; most accessible tissue: Callus, score: 81.664 N N N N
vg0507786958 C -> T LOC_Os05g13980-LOC_Os05g13990 intergenic_region ; MODIFIER silent_mutation Average:59.652; most accessible tissue: Callus, score: 81.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507786958 NA 1.52E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 3.10E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 5.36E-07 8.42E-23 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 4.12E-16 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 1.22E-06 4.95E-17 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 1.48E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 2.51E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 4.69E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 3.08E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 8.12E-11 1.41E-26 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 7.17E-06 2.07E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 2.14E-09 1.46E-19 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 5.15E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 5.77E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 2.38E-09 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 3.80E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507786958 NA 9.84E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251