\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507651613:

Variant ID: vg0507651613 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7651613
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.46, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATGCACACTATACCATCCAAATCCTGACACCCTTACCATGCCCGAAGTTTGGTACTGGTTAACATGCACATTTTCTTTAGATCTGGGTATATATAGT[A/G]
TTAACGTGAGGGTTATGTGGAGCCGATCGGCCAACAAAATAGGCCTGGCAGGATTGGCTCGCTGGCTATAGGAGACGGGGATATGAATATGTCATGCTGG

Reverse complement sequence

CCAGCATGACATATTCATATCCCCGTCTCCTATAGCCAGCGAGCCAATCCTGCCAGGCCTATTTTGTTGGCCGATCGGCTCCACATAACCCTCACGTTAA[T/C]
ACTATATATACCCAGATCTAAAGAAAATGTGCATGTTAACCAGTACCAAACTTCGGGCATGGTAAGGGTGTCAGGATTTGGATGGTATAGTGTGCATTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 21.60% 22.11% 14.24% NA
All Indica  2759 13.60% 31.20% 31.61% 23.52% NA
All Japonica  1512 92.00% 6.00% 1.79% 0.26% NA
Aus  269 27.10% 21.60% 46.47% 4.83% NA
Indica I  595 3.40% 23.90% 45.38% 27.39% NA
Indica II  465 25.40% 17.00% 27.74% 29.89% NA
Indica III  913 15.60% 42.20% 23.77% 18.51% NA
Indica Intermediate  786 12.20% 32.60% 32.57% 22.65% NA
Temperate Japonica  767 97.80% 0.70% 1.43% 0.13% NA
Tropical Japonica  504 81.20% 15.50% 2.98% 0.40% NA
Japonica Intermediate  241 96.30% 2.90% 0.41% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 60.00% 10.00% 22.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507651613 A -> DEL N N silent_mutation Average:32.27; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0507651613 A -> G LOC_Os05g13780.1 upstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:32.27; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0507651613 A -> G LOC_Os05g13790.1 upstream_gene_variant ; 3422.0bp to feature; MODIFIER silent_mutation Average:32.27; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0507651613 A -> G LOC_Os05g13800.1 intron_variant ; MODIFIER silent_mutation Average:32.27; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507651613 NA 3.61E-26 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 1.47E-27 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 2.92E-07 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 1.42E-30 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 3.12E-06 2.24E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 1.59E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 4.02E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 5.67E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 1.64E-06 1.51E-38 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 9.60E-07 4.36E-09 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 1.32E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 7.18E-13 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 3.11E-35 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507651613 NA 1.02E-15 mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251