Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507563644:

Variant ID: vg0507563644 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7563644
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GATTAAGTTTGGTTAATTAGGGTTTATTAATTGGTGGACGCGTAATAAATTACCAGGTTCTGTTTGTTATCAATAATCTCTGATGTGAAAAGAAATATAG[C/T]
CTAGTGGTTGCAGTGACTTAAGTAGCACCTTAAGATCCTGAGTTCTAATCTCCATATGAGGACTAAGTTCCCTATTTGACAAGTTAAGTTCCTAATTTAA

Reverse complement sequence

TTAAATTAGGAACTTAACTTGTCAAATAGGGAACTTAGTCCTCATATGGAGATTAGAACTCAGGATCTTAAGGTGCTACTTAAGTCACTGCAACCACTAG[G/A]
CTATATTTCTTTTCACATCAGAGATTATTGATAACAAACAGAACCTGGTAATTTATTACGCGTCCACCAATTAATAAACCCTAATTAACCAAACTTAATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	5.60%	0.21%	0.00%	NA
All Indica	2759	96.30%	3.30%	0.36%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	39.00%	61.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	97.40%	2.50%	0.11%	0.00%	NA
Indica Intermediate	786	94.30%	4.70%	1.02%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507563644	C -> T	LOC_Os05g13640.1	upstream_gene_variant ; 3515.0bp to feature; MODIFIER	silent_mutation	Average:56.977; most accessible tissue: Zhenshan97 panicle, score: 94.949	N	N	N	N
vg0507563644	C -> T	LOC_Os05g13660.1	upstream_gene_variant ; 2737.0bp to feature; MODIFIER	silent_mutation	Average:56.977; most accessible tissue: Zhenshan97 panicle, score: 94.949	N	N	N	N
vg0507563644	C -> T	LOC_Os05g13630.1	downstream_gene_variant ; 4438.0bp to feature; MODIFIER	silent_mutation	Average:56.977; most accessible tissue: Zhenshan97 panicle, score: 94.949	N	N	N	N
vg0507563644	C -> T	LOC_Os05g13650.1	downstream_gene_variant ; 248.0bp to feature; MODIFIER	silent_mutation	Average:56.977; most accessible tissue: Zhenshan97 panicle, score: 94.949	N	N	N	N
vg0507563644	C -> T	LOC_Os05g13650-LOC_Os05g13660	intergenic_region ; MODIFIER	silent_mutation	Average:56.977; most accessible tissue: Zhenshan97 panicle, score: 94.949	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0507563644	C	T	0.07	0.0	-0.01	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507563644	NA	4.92E-16	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	8.78E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	2.41E-07	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	7.39E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	2.29E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	6.37E-07	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	4.60E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	3.79E-06	mr1349	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	5.13E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	8.08E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	1.74E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	1.48E-06	1.48E-06	mr1396	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	1.39E-06	mr1438	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	NA	1.39E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507563644	2.52E-06	2.52E-06	mr1481	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251