Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507524947:

Variant ID: vg0507524947 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7524947
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAAACTTTGGAGTTACTGTTAACTTTCATAGAAATCTGGAATGTCCTTTAAAAGGAAACTATAGGATTCAATCCTATGTTTCAGAAGCCTTCTTACG[A/G]
ACTTTTCATGTAGGATTAAAATCCTACAAATTAAAGGGGCATTTATCCTATGTTTTTCCTCTATTCTAAAGGAACCCTGTAAGTTCTAATTAGTTCACCA

Reverse complement sequence

TGGTGAACTAATTAGAACTTACAGGGTTCCTTTAGAATAGAGGAAAAACATAGGATAAATGCCCCTTTAATTTGTAGGATTTTAATCCTACATGAAAAGT[T/C]
CGTAAGAAGGCTTCTGAAACATAGGATTGAATCCTATAGTTTCCTTTTAAAGGACATTCCAGATTTCTATGAAAGTTAACAGTAACTCCAAAGTTTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	6.50%	2.01%	0.57%	NA
All Indica	2759	97.40%	1.10%	0.54%	0.98%	NA
All Japonica	1512	77.20%	17.90%	4.89%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.00%	0.00%	0.34%	0.67%	NA
Indica II	465	95.50%	2.80%	1.72%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	94.30%	2.30%	0.51%	2.93%	NA
Temperate Japonica	767	91.90%	3.80%	4.30%	0.00%	NA
Tropical Japonica	504	57.50%	37.50%	4.96%	0.00%	NA
Japonica Intermediate	241	71.40%	22.00%	6.64%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	7.80%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507524947	A -> DEL	N	N	silent_mutation	Average:37.862; most accessible tissue: Callus, score: 53.041	N	N	N	N
vg0507524947	A -> G	LOC_Os05g13560.1	upstream_gene_variant ; 3295.0bp to feature; MODIFIER	silent_mutation	Average:37.862; most accessible tissue: Callus, score: 53.041	N	N	N	N
vg0507524947	A -> G	LOC_Os05g13570.1	downstream_gene_variant ; 4777.0bp to feature; MODIFIER	silent_mutation	Average:37.862; most accessible tissue: Callus, score: 53.041	N	N	N	N
vg0507524947	A -> G	LOC_Os05g13560-LOC_Os05g13570	intergenic_region ; MODIFIER	silent_mutation	Average:37.862; most accessible tissue: Callus, score: 53.041	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507524947	NA	3.69E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	8.69E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	6.42E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	5.81E-11	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	3.31E-18	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	6.70E-06	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	2.80E-08	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	6.17E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	2.57E-11	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	7.85E-11	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	7.79E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	1.66E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	4.41E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	6.46E-06	7.12E-15	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	4.38E-06	9.88E-21	mr1769_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947	NA	1.13E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251