\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507524947:

Variant ID: vg0507524947 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7524947
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAAACTTTGGAGTTACTGTTAACTTTCATAGAAATCTGGAATGTCCTTTAAAAGGAAACTATAGGATTCAATCCTATGTTTCAGAAGCCTTCTTACG[A/G]
ACTTTTCATGTAGGATTAAAATCCTACAAATTAAAGGGGCATTTATCCTATGTTTTTCCTCTATTCTAAAGGAACCCTGTAAGTTCTAATTAGTTCACCA

Reverse complement sequence

TGGTGAACTAATTAGAACTTACAGGGTTCCTTTAGAATAGAGGAAAAACATAGGATAAATGCCCCTTTAATTTGTAGGATTTTAATCCTACATGAAAAGT[T/C]
CGTAAGAAGGCTTCTGAAACATAGGATTGAATCCTATAGTTTCCTTTTAAAGGACATTCCAGATTTCTATGAAAGTTAACAGTAACTCCAAAGTTTTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 6.50% 2.01% 0.57% NA
All Indica  2759 97.40% 1.10% 0.54% 0.98% NA
All Japonica  1512 77.20% 17.90% 4.89% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.00% 0.00% 0.34% 0.67% NA
Indica II  465 95.50% 2.80% 1.72% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 94.30% 2.30% 0.51% 2.93% NA
Temperate Japonica  767 91.90% 3.80% 4.30% 0.00% NA
Tropical Japonica  504 57.50% 37.50% 4.96% 0.00% NA
Japonica Intermediate  241 71.40% 22.00% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507524947 A -> DEL N N silent_mutation Average:37.862; most accessible tissue: Callus, score: 53.041 N N N N
vg0507524947 A -> G LOC_Os05g13560.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:37.862; most accessible tissue: Callus, score: 53.041 N N N N
vg0507524947 A -> G LOC_Os05g13570.1 downstream_gene_variant ; 4777.0bp to feature; MODIFIER silent_mutation Average:37.862; most accessible tissue: Callus, score: 53.041 N N N N
vg0507524947 A -> G LOC_Os05g13560-LOC_Os05g13570 intergenic_region ; MODIFIER silent_mutation Average:37.862; most accessible tissue: Callus, score: 53.041 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507524947 NA 3.69E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 8.69E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 6.42E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 5.81E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 3.31E-18 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 6.70E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 2.80E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 6.17E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 2.57E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 7.85E-11 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 7.79E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 1.66E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 4.41E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 6.46E-06 7.12E-15 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 4.38E-06 9.88E-21 mr1769_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507524947 NA 1.13E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251