\
| Variant ID: vg0507368901 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7368901 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.04, others allele: 0.00, population size: 103. )
AGTACATCACAAAACATAATCTATGGAATAAATTAGTAATGTTGTTGATAAATCCCAATGCAGGAAAAAAATATCCTTATATAATTTTAGATTTGTATAA[C/A]
AAATATTTTTTAAAAAATAACAGCCAAACACCACGGTATTAACTATTCAGTGCTTAAAAAGAAGAATCCAGGGTATTTTGTGATTTCTGGAAATTCCGAG
CTCGGAATTTCCAGAAATCACAAAATACCCTGGATTCTTCTTTTTAAGCACTGAATAGTTAATACCGTGGTGTTTGGCTGTTATTTTTTAAAAAATATTT[G/T]
TTATACAAATCTAAAATTATATAAGGATATTTTTTTCCTGCATTGGGATTTATCAACAACATTACTAATTTATTCCATAGATTATGTTTTGTGATGTACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.80% | 49.50% | 0.68% | 0.00% | NA |
| All Indica | 2759 | 21.70% | 77.30% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 91.50% | 8.20% | 0.26% | 0.00% | NA |
| Aus | 269 | 81.80% | 17.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 37.20% | 60.20% | 2.58% | 0.00% | NA |
| Indica III | 913 | 25.40% | 73.60% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 22.30% | 77.00% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.20% | 20.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507368901 | C -> A | LOC_Os05g13300.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.389; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507368901 | 6.60E-06 | NA | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 3.76E-07 | 3.61E-13 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | NA | 5.56E-13 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 9.29E-06 | NA | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 2.22E-06 | 3.51E-14 | mr1593 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | NA | 2.88E-06 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | NA | 6.22E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 6.36E-07 | 3.22E-14 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 9.78E-06 | NA | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | 1.46E-07 | 1.31E-15 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | NA | 4.20E-11 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507368901 | NA | 1.63E-06 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |