\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507360699:

Variant ID: vg0507360699 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7360699
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTGCAGCATGGACTCCAAGACGTAATAAGTGTATGGCAAGTGGGACCAGGTATTAATAGTATAGTAAATAACTATTGTATGAATTGGCTGGTAGATTG[A/G]
CTATAGATGAATTGAAGTTAGTAGTGGGCTATACTATTAAACTTGCTCTAAGAGTAAGGATAATAGTGAGCTATAAGCAAGCTATATAAAAGTAGGGAGT

Reverse complement sequence

ACTCCCTACTTTTATATAGCTTGCTTATAGCTCACTATTATCCTTACTCTTAGAGCAAGTTTAATAGTATAGCCCACTACTAACTTCAATTCATCTATAG[T/C]
CAATCTACCAGCCAATTCATACAATAGTTATTTACTATACTATTAATACCTGGTCCCACTTGCCATACACTTATTACGTCTTGGAGTCCATGCTGCAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.00% 18.20% 7.26% 45.60% NA
All Indica  2759 21.80% 1.70% 5.91% 70.61% NA
All Japonica  1512 45.00% 46.80% 5.95% 2.25% NA
Aus  269 15.20% 0.70% 29.37% 54.65% NA
Indica I  595 1.20% 1.30% 1.18% 96.30% NA
Indica II  465 47.30% 2.20% 1.94% 48.60% NA
Indica III  913 26.50% 1.50% 10.62% 61.34% NA
Indica Intermediate  786 16.90% 1.80% 6.36% 74.94% NA
Temperate Japonica  767 18.40% 79.90% 0.26% 1.43% NA
Tropical Japonica  504 73.60% 6.30% 15.67% 4.37% NA
Japonica Intermediate  241 69.70% 26.10% 3.73% 0.41% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 41.10% 18.90% 12.22% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507360699 A -> DEL N N silent_mutation Average:24.513; most accessible tissue: Callus, score: 72.739 N N N N
vg0507360699 A -> G LOC_Os05g12808.1 upstream_gene_variant ; 3030.0bp to feature; MODIFIER silent_mutation Average:24.513; most accessible tissue: Callus, score: 72.739 N N N N
vg0507360699 A -> G LOC_Os05g12808-LOC_Os05g13300 intergenic_region ; MODIFIER silent_mutation Average:24.513; most accessible tissue: Callus, score: 72.739 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507360699 NA 1.20E-09 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 5.32E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 2.47E-08 2.94E-22 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 6.48E-16 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 3.94E-07 1.17E-15 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 3.22E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 2.01E-06 4.70E-11 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 5.57E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 4.63E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 1.49E-23 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 2.01E-14 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 2.68E-06 NA mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 1.20E-07 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507360699 NA 2.39E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251