\
| Variant ID: vg0507350915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7350915 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 191. )
CCATCGGCGGGGTGTCTCAGCATCCCGCCCTTTTGACGTTCTTCAGCGTGCCAACGTATCATTCTAGCATTCCCCTTGTTCTTGAACAAACGCCTTAGCC[G/A]
TGGTATTATAGGAAAATACCACATCACCTTAGCAGGAATTCTCTTCTTCTTTAGCTGCCCGTCAACTTCACCTGGATCATCTCGTCTAATCTTGTATCGT
ACGATACAAGATTAGACGAGATGATCCAGGTGAAGTTGACGGGCAGCTAAAGAAGAAGAGAATTCCTGCTAAGGTGATGTGGTATTTTCCTATAATACCA[C/T]
GGCTAAGGCGTTTGTTCAAGAACAAGGGGAATGCTAGAATGATACGTTGGCACGCTGAAGAACGTCAAAAGGGCGGGATGCTGAGACACCCCGCCGATGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.60% | 24.90% | 12.38% | 32.04% | NA |
| All Indica | 2759 | 21.80% | 8.80% | 17.00% | 52.41% | NA |
| All Japonica | 1512 | 50.30% | 48.60% | 0.26% | 0.79% | NA |
| Aus | 269 | 15.20% | 34.20% | 36.80% | 13.75% | NA |
| Indica I | 595 | 1.50% | 8.10% | 12.44% | 77.98% | NA |
| Indica II | 465 | 47.50% | 4.90% | 6.45% | 41.08% | NA |
| Indica III | 913 | 26.00% | 8.90% | 23.77% | 41.40% | NA |
| Indica Intermediate | 786 | 17.00% | 11.60% | 18.83% | 52.54% | NA |
| Temperate Japonica | 767 | 18.80% | 79.90% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 89.10% | 9.90% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 69.70% | 29.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 26.70% | 13.33% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507350915 | G -> DEL | LOC_Os05g12804.1 | N | frameshift_variant | Average:21.149; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0507350915 | G -> A | LOC_Os05g12804.1 | missense_variant ; p.Arg205Trp; MODERATE | nonsynonymous_codon ; R205W | Average:21.149; most accessible tissue: Zhenshan97 panicle, score: 36.038 | benign |
0.991 |
TOLERATED | 0.06 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507350915 | NA | 3.58E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507350915 | 2.71E-06 | 2.12E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 1.01E-11 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 2.52E-07 | 4.32E-22 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 7.57E-14 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 1.06E-08 | 2.59E-22 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 1.37E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 1.99E-07 | 3.39E-12 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 2.74E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 6.54E-07 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 7.35E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 1.49E-09 | 1.05E-28 | mr1593_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 6.20E-16 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 5.60E-09 | 5.87E-25 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | 4.23E-06 | 1.26E-08 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 7.57E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507350915 | NA | 3.46E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |