Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507336970:

Variant ID: vg0507336970 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7336970
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.20, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTTTTCCTTGAATGTAGAAAACCTCAAAGTCTTCTCATCCTAATTTTCAGAACAAGTTTCCAAGAATTAACAGGTGAAGAGAGACTAGGCGACCAGTC[C/T]
ACTAGATTATCACTTGACTTGAATTGCTATTCACTTCACCTTGCCTCAGGAGTCTGTGAGGTAGCTCACTTGTATTAGTGGTGTTGGTTTAGATCAAACG

Reverse complement sequence

CGTTTGATCTAAACCAACACCACTAATACAAGTGAGCTACCTCACAGACTCCTGAGGCAAGGTGAAGTGAATAGCAATTCAAGTCAAGTGATAATCTAGT[G/A]
GACTGGTCGCCTAGTCTCTCTTCACCTGTTAATTCTTGGAAACTTGTTCTGAAAATTAGGATGAGAAGACTTTGAGGTTTTCTACATTCAAGGAAAAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	48.30%	0.04%	0.55%	NA
All Indica	2759	27.30%	71.90%	0.07%	0.72%	NA
All Japonica	1512	97.00%	2.60%	0.00%	0.33%	NA
Aus	269	19.00%	81.00%	0.00%	0.00%	NA
Indica I	595	7.20%	92.80%	0.00%	0.00%	NA
Indica II	465	51.20%	47.50%	0.43%	0.86%	NA
Indica III	913	31.70%	67.40%	0.00%	0.99%	NA
Indica Intermediate	786	23.20%	76.00%	0.00%	0.89%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.20%	0.00%	0.60%	NA
Japonica Intermediate	241	95.40%	3.70%	0.00%	0.83%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507336970	C -> T	LOC_Os05g12780.1	upstream_gene_variant ; 1837.0bp to feature; MODIFIER	silent_mutation	Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0507336970	C -> T	LOC_Os05g12790.1	downstream_gene_variant ; 2351.0bp to feature; MODIFIER	silent_mutation	Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0507336970	C -> T	LOC_Os05g12800.1	downstream_gene_variant ; 4133.0bp to feature; MODIFIER	silent_mutation	Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0507336970	C -> T	LOC_Os05g12780-LOC_Os05g12790	intergenic_region ; MODIFIER	silent_mutation	Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N
vg0507336970	C -> DEL	N	N	silent_mutation	Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507336970	NA	1.27E-10	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	2.51E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	2.19E-06	mr1169	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	1.11E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	8.99E-07	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	2.61E-08	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	6.07E-19	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	1.85E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	5.10E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	4.60E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	9.34E-13	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	6.99E-20	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	3.89E-09	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	7.73E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	5.52E-19	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	2.69E-10	mr1645_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	5.04E-06	mr1645_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	4.22E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	4.38E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	8.84E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	6.95E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	4.51E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970	NA	6.00E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251