\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507336970:

Variant ID: vg0507336970 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7336970
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.20, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTTTCCTTGAATGTAGAAAACCTCAAAGTCTTCTCATCCTAATTTTCAGAACAAGTTTCCAAGAATTAACAGGTGAAGAGAGACTAGGCGACCAGTC[C/T]
ACTAGATTATCACTTGACTTGAATTGCTATTCACTTCACCTTGCCTCAGGAGTCTGTGAGGTAGCTCACTTGTATTAGTGGTGTTGGTTTAGATCAAACG

Reverse complement sequence

CGTTTGATCTAAACCAACACCACTAATACAAGTGAGCTACCTCACAGACTCCTGAGGCAAGGTGAAGTGAATAGCAATTCAAGTCAAGTGATAATCTAGT[G/A]
GACTGGTCGCCTAGTCTCTCTTCACCTGTTAATTCTTGGAAACTTGTTCTGAAAATTAGGATGAGAAGACTTTGAGGTTTTCTACATTCAAGGAAAAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.30% 0.04% 0.55% NA
All Indica  2759 27.30% 71.90% 0.07% 0.72% NA
All Japonica  1512 97.00% 2.60% 0.00% 0.33% NA
Aus  269 19.00% 81.00% 0.00% 0.00% NA
Indica I  595 7.20% 92.80% 0.00% 0.00% NA
Indica II  465 51.20% 47.50% 0.43% 0.86% NA
Indica III  913 31.70% 67.40% 0.00% 0.99% NA
Indica Intermediate  786 23.20% 76.00% 0.00% 0.89% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507336970 C -> T LOC_Os05g12780.1 upstream_gene_variant ; 1837.0bp to feature; MODIFIER silent_mutation Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041 N N N N
vg0507336970 C -> T LOC_Os05g12790.1 downstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041 N N N N
vg0507336970 C -> T LOC_Os05g12800.1 downstream_gene_variant ; 4133.0bp to feature; MODIFIER silent_mutation Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041 N N N N
vg0507336970 C -> T LOC_Os05g12780-LOC_Os05g12790 intergenic_region ; MODIFIER silent_mutation Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041 N N N N
vg0507336970 C -> DEL N N silent_mutation Average:68.588; most accessible tissue: Minghui63 flower, score: 78.041 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507336970 NA 1.27E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 2.51E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 2.19E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 1.11E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 8.99E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 2.61E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 6.07E-19 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 1.85E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 5.10E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 4.60E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 9.34E-13 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 6.99E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 3.89E-09 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 7.73E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 5.52E-19 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 2.69E-10 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 5.04E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 4.22E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 4.38E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 8.84E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 6.95E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 4.51E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507336970 NA 6.00E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251