\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507313026:

Variant ID: vg0507313026 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7313026
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GCTATGTACTTATATAGTTCATCCTCATCCTCACTTAGTGTTATTTCTCTCTTCTCTCATTAAGTCATACCACATCAATTATTTTAATGCTTAAATGATT[G/A]
GTCTATGGTCTAAATTATCTCTCTCCTTTTCTTCTCTCATTAATCCATATCACCGCAATTGTTTTTAAGCCTTAAGATGATTAATCTACAGGTTCAAACT

Reverse complement sequence

AGTTTGAACCTGTAGATTAATCATCTTAAGGCTTAAAAACAATTGCGGTGATATGGATTAATGAGAGAAGAAAAGGAGAGAGATAATTTAGACCATAGAC[C/T]
AATCATTTAAGCATTAAAATAATTGATGTGGTATGACTTAATGAGAGAAGAGAGAAATAACACTAAGTGAGGATGAGGATGAACTATATAAGTACATAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.00% 0.21% 0.42% NA
All Indica  2759 38.80% 60.30% 0.29% 0.54% NA
All Japonica  1512 97.90% 1.70% 0.07% 0.26% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 18.50% 81.30% 0.17% 0.00% NA
Indica II  465 74.00% 25.60% 0.43% 0.00% NA
Indica III  913 37.90% 60.70% 0.55% 0.88% NA
Indica Intermediate  786 34.50% 64.60% 0.00% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 3.40% 0.20% 0.40% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507313026 G -> DEL N N silent_mutation Average:35.944; most accessible tissue: Callus, score: 51.378 N N N N
vg0507313026 G -> A LOC_Os05g12740.1 downstream_gene_variant ; 1792.0bp to feature; MODIFIER silent_mutation Average:35.944; most accessible tissue: Callus, score: 51.378 N N N N
vg0507313026 G -> A LOC_Os05g12740-LOC_Os05g12750 intergenic_region ; MODIFIER silent_mutation Average:35.944; most accessible tissue: Callus, score: 51.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507313026 NA 1.90E-12 mr1050 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.54E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 4.80E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 9.06E-15 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 2.44E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 6.55E-07 1.08E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 8.57E-22 7.24E-23 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 4.04E-24 4.76E-49 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 5.30E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 2.17E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 7.66E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.59E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 3.09E-07 7.17E-29 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 2.25E-08 1.41E-19 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 9.93E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 7.00E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 6.36E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 2.51E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.88E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.41E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.26E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 8.56E-09 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 8.02E-29 3.82E-31 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 1.59E-30 6.18E-62 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 5.37E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 2.96E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 8.15E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 1.94E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 7.56E-06 NA mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 8.07E-06 4.59E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 8.94E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507313026 NA 6.60E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251