\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507267164:

Variant ID: vg0507267164 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7267164
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATTCATGGGACGGCCCTGTTCAAGCTACCTCTTCAAAATATACCTCCTCTCTCTAAGCTGAACTTGCAGGTATAATACTAGCATAGTAGCATACAAG[G/A]
TGTGTTCCAGACTTCAAATACAACATCCAATCTTCATTTCAGATAACCAATCCCTGCTCTCCATGCTACAAACAACAACACTTTGCACATTATGCACTAC

Reverse complement sequence

GTAGTGCATAATGTGCAAAGTGTTGTTGTTTGTAGCATGGAGAGCAGGGATTGGTTATCTGAAATGAAGATTGGATGTTGTATTTGAAGTCTGGAACACA[C/T]
CTTGTATGCTACTATGCTAGTATTATACCTGCAAGTTCAGCTTAGAGAGAGGAGGTATATTTTGAAGAGGTAGCTTGAACAGGGCCGTCCCATGAATTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 39.60% 0.06% 0.76% NA
All Indica  2759 40.50% 58.40% 0.11% 1.05% NA
All Japonica  1512 97.90% 1.80% 0.00% 0.33% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 19.50% 80.50% 0.00% 0.00% NA
Indica II  465 74.00% 24.70% 0.00% 1.29% NA
Indica III  913 40.70% 57.70% 0.11% 1.42% NA
Indica Intermediate  786 36.30% 62.20% 0.25% 1.27% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 3.60% 0.00% 0.60% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507267164 G -> DEL N N silent_mutation Average:47.437; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0507267164 G -> A LOC_Os05g12660.1 upstream_gene_variant ; 2105.0bp to feature; MODIFIER silent_mutation Average:47.437; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0507267164 G -> A LOC_Os05g12670.1 downstream_gene_variant ; 4527.0bp to feature; MODIFIER silent_mutation Average:47.437; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N
vg0507267164 G -> A LOC_Os05g12640-LOC_Os05g12660 intergenic_region ; MODIFIER silent_mutation Average:47.437; most accessible tissue: Zhenshan97 young leaf, score: 79.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507267164 NA 1.39E-11 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.60E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 5.26E-15 mr1272 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 3.29E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 4.53E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 5.17E-07 3.66E-11 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 4.18E-15 2.85E-19 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 7.39E-19 5.81E-41 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 5.35E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 2.34E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.85E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 2.13E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 8.64E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 5.02E-06 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 7.40E-08 3.53E-30 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 7.50E-10 2.09E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 6.69E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.07E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.42E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 2.79E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 8.55E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 9.42E-09 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 1.63E-22 1.33E-28 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 3.06E-27 7.24E-57 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.86E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.26E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.00E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 2.62E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 5.29E-06 1.15E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 4.30E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507267164 NA 1.22E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251