Variant ID: vg0507253850 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 7253850 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTATTGAATAAAGTCTTACAAGAGAGGAAGAGCTACTAGAACCATACCCGACTTCTCTGCAAGACATGAAGAACTAAGGAAGAATATTTAATTCTAACT[C/T]
TACTAGCACTAGAGCAAAATATGTAAACTAGGGTTGCGCTCGTTACCTCCTGTTCCCAACTTCCCTTCCTCGTTTTCCACGCGCACGCTTTTCAAACTGC
GCAGTTTGAAAAGCGTGCGCGTGGAAAACGAGGAAGGGAAGTTGGGAACAGGAGGTAACGAGCGCAACCCTAGTTTACATATTTTGCTCTAGTGCTAGTA[G/A]
AGTTAGAATTAAATATTCTTCCTTAGTTCTTCATGTCTTGCAGAGAAGTCGGGTATGGTTCTAGTAGCTCTTCCTCTCTTGTAAGACTTTATTCAATAAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 54.70% | 7.00% | 1.69% | 36.58% | NA |
All Indica | 2759 | 58.10% | 5.70% | 1.92% | 34.29% | NA |
All Japonica | 1512 | 57.10% | 0.70% | 1.19% | 41.01% | NA |
Aus | 269 | 21.90% | 58.70% | 1.49% | 17.84% | NA |
Indica I | 595 | 73.30% | 10.30% | 0.17% | 16.30% | NA |
Indica II | 465 | 31.40% | 0.20% | 3.44% | 64.95% | NA |
Indica III | 913 | 59.30% | 4.20% | 2.74% | 33.84% | NA |
Indica Intermediate | 786 | 61.20% | 7.10% | 1.40% | 30.28% | NA |
Temperate Japonica | 767 | 91.40% | 0.40% | 0.52% | 7.69% | NA |
Tropical Japonica | 504 | 13.50% | 0.60% | 1.98% | 83.93% | NA |
Japonica Intermediate | 241 | 39.40% | 1.70% | 1.66% | 57.26% | NA |
VI/Aromatic | 96 | 15.60% | 2.10% | 2.08% | 80.21% | NA |
Intermediate | 90 | 47.80% | 6.70% | 3.33% | 42.22% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0507253850 | C -> T | LOC_Os05g12640.1 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12640.2 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12640.4 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12640.6 | upstream_gene_variant ; 1659.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12640.3 | upstream_gene_variant ; 1661.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12630.1 | downstream_gene_variant ; 2453.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12630.2 | downstream_gene_variant ; 2453.0bp to feature; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> T | LOC_Os05g12630-LOC_Os05g12640 | intergenic_region ; MODIFIER | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
vg0507253850 | C -> DEL | N | N | silent_mutation | Average:33.899; most accessible tissue: Zhenshan97 root, score: 44.635 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0507253850 | NA | 2.88E-08 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0507253850 | NA | 1.72E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0507253850 | NA | 1.11E-06 | mr1397 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0507253850 | 9.30E-06 | NA | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0507253850 | 1.78E-06 | 5.28E-08 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0507253850 | 6.59E-08 | 1.23E-06 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |