\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507210481:

Variant ID: vg0507210481 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7210481
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAAGGGGAGGAGGGGGAGGAGGAAGGGGAGGATGGGGAGGAGAGGAGGAAGGGGAGGAGGTGGAGGAGAGAGGATGAGGAAGAGAGGTTAGATCTTAG[G/A]
AGAGGGGAGAGATTCGATCTGTCTAAGTTGTAATTGTGGAGGAGAGGATAAGTGATCTTTAGTCCTGGTTATTGACACCAACCGGGACTAAAGATCCTCG

Reverse complement sequence

CGAGGATCTTTAGTCCCGGTTGGTGTCAATAACCAGGACTAAAGATCACTTATCCTCTCCTCCACAATTACAACTTAGACAGATCGAATCTCTCCCCTCT[C/T]
CTAAGATCTAACCTCTCTTCCTCATCCTCTCTCCTCCACCTCCTCCCCTTCCTCCTCTCCTCCCCATCCTCCCCTTCCTCCTCCCCCTCCTCCCCTTCCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 41.50% 0.57% 0.00% NA
All Indica  2759 37.70% 61.50% 0.76% 0.00% NA
All Japonica  1512 98.10% 1.70% 0.26% 0.00% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 17.30% 82.70% 0.00% 0.00% NA
Indica II  465 73.50% 26.20% 0.22% 0.00% NA
Indica III  913 37.00% 61.40% 1.53% 0.00% NA
Indica Intermediate  786 32.80% 66.40% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.20% 0.40% 0.00% NA
Japonica Intermediate  241 95.40% 3.70% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507210481 G -> A LOC_Os05g12560.1 upstream_gene_variant ; 672.0bp to feature; MODIFIER silent_mutation Average:49.638; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0507210481 G -> A LOC_Os05g12570.1 upstream_gene_variant ; 1246.0bp to feature; MODIFIER silent_mutation Average:49.638; most accessible tissue: Minghui63 root, score: 59.984 N N N N
vg0507210481 G -> A LOC_Os05g12560-LOC_Os05g12570 intergenic_region ; MODIFIER silent_mutation Average:49.638; most accessible tissue: Minghui63 root, score: 59.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507210481 NA 3.27E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 7.09E-11 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 1.44E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 5.71E-06 2.02E-08 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 9.53E-14 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 2.13E-06 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 3.52E-06 1.98E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 5.79E-29 2.97E-26 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 1.21E-30 4.88E-59 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 8.42E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 3.69E-09 2.69E-31 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 7.88E-11 1.19E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 4.91E-11 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 3.18E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 2.09E-09 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 1.05E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 7.33E-11 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 1.46E-34 5.03E-34 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 6.22E-34 3.47E-70 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 1.94E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 1.02E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 6.48E-08 NA mr1807_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 2.52E-08 1.42E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507210481 NA 2.13E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251