\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507197516:

Variant ID: vg0507197516 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7197516
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCAAAATGCAATTCAGACAACATCTAAAATTCAAATGGTCATATATTGACTATTTGAACTCGGAATTGACTCGTTCAAATTGCTAATTTTCCCTTAAT[C/A]
AGTAAAGAACCCATTTTAGTGCTTTGTTTCTGCATCTTATATGGTTTTAATTTATGTTTTAGCCCTTTTTCTTTGCGTATGCAGTGTAGACGCTGCAGAT

Reverse complement sequence

ATCTGCAGCGTCTACACTGCATACGCAAAGAAAAAGGGCTAAAACATAAATTAAAACCATATAAGATGCAGAAACAAAGCACTAAAATGGGTTCTTTACT[G/T]
ATTAAGGGAAAATTAGCAATTTGAACGAGTCAATTCCGAGTTCAAATAGTCAATATATGACCATTTGAATTTTAGATGTTGTCTGAATTGCATTTTGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 38.60% 1.12% 1.27% NA
All Indica  2759 39.60% 56.60% 1.92% 1.88% NA
All Japonica  1512 98.00% 1.70% 0.00% 0.33% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 19.00% 76.60% 3.53% 0.84% NA
Indica II  465 73.10% 26.00% 0.00% 0.86% NA
Indica III  913 38.70% 56.10% 2.08% 3.18% NA
Indica Intermediate  786 36.50% 60.10% 1.65% 1.78% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 23.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507197516 C -> DEL N N silent_mutation Average:65.992; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0507197516 C -> A LOC_Os05g12510.1 downstream_gene_variant ; 2474.0bp to feature; MODIFIER silent_mutation Average:65.992; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0507197516 C -> A LOC_Os05g12540.1 downstream_gene_variant ; 1536.0bp to feature; MODIFIER silent_mutation Average:65.992; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0507197516 C -> A LOC_Os05g12550.1 downstream_gene_variant ; 2610.0bp to feature; MODIFIER silent_mutation Average:65.992; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N
vg0507197516 C -> A LOC_Os05g12510-LOC_Os05g12540 intergenic_region ; MODIFIER silent_mutation Average:65.992; most accessible tissue: Zhenshan97 young leaf, score: 79.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507197516 NA 7.43E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 9.14E-06 2.99E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 6.22E-07 4.29E-10 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 2.18E-13 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.11E-08 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.29E-08 9.61E-13 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.24E-30 2.77E-26 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.63E-34 4.98E-61 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 3.22E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.99E-11 1.43E-33 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 3.84E-13 7.45E-25 mr1195_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 4.89E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 1.28E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 9.71E-09 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 3.15E-07 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 4.75E-09 3.33E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 2.58E-40 1.63E-36 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 1.84E-44 2.37E-82 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 NA 8.32E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 8.34E-06 NA mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507197516 2.51E-06 4.85E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251