\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507191831:

Variant ID: vg0507191831 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7191831
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTTTATCTTTTTTTGTTACAGCTAAAATATAATGAATTTGAAAATAAGATTTCACACGAACGTGTAATACTATTAGGAGGGAATGTCCAATTTTTTT[G/T]
TAGAATTTTCTGTGATATTTGCTAGTTGGTGTGCACGGGAAGCTTTGTGTGCATAGGATATGTTTCCTTCTTACCTATAAATTCATGTATATTACACCAT

Reverse complement sequence

ATGGTGTAATATACATGAATTTATAGGTAAGAAGGAAACATATCCTATGCACACAAAGCTTCCCGTGCACACCAACTAGCAAATATCACAGAAAATTCTA[C/A]
AAAAAAATTGGACATTCCCTCCTAATAGTATTACACGTTCGTGTGAAATCTTATTTTCAAATTCATTATATTTTAGCTGTAACAAAAAAAGATAAAATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 32.90% 0.19% 0.49% NA
All Indica  2759 45.90% 53.20% 0.25% 0.65% NA
All Japonica  1512 99.30% 0.40% 0.13% 0.20% NA
Aus  269 77.70% 22.30% 0.00% 0.00% NA
Indica I  595 28.60% 71.30% 0.00% 0.17% NA
Indica II  465 74.60% 24.50% 0.43% 0.43% NA
Indica III  913 43.20% 55.60% 0.33% 0.88% NA
Indica Intermediate  786 45.20% 53.70% 0.25% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 0.80% 0.40% 0.20% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 21.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507191831 G -> T LOC_Os05g12510.1 upstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:40.068; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N
vg0507191831 G -> T LOC_Os05g12500-LOC_Os05g12510 intergenic_region ; MODIFIER silent_mutation Average:40.068; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N
vg0507191831 G -> DEL N N silent_mutation Average:40.068; most accessible tissue: Zhenshan97 flower, score: 93.851 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507191831 G T 0.02 0.0 0.0 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507191831 8.07E-09 2.49E-18 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 2.03E-06 8.13E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 2.69E-08 1.15E-20 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 2.88E-08 5.90E-12 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 4.43E-44 8.60E-43 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 5.12E-37 1.69E-65 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 NA 2.15E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 NA 7.48E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 4.00E-14 6.93E-37 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 3.94E-12 4.64E-23 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 NA 1.16E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 6.33E-09 1.90E-25 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 1.55E-09 1.43E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 3.49E-49 1.89E-49 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 2.71E-40 1.05E-83 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 5.88E-07 NA mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507191831 2.53E-06 1.06E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251